Previous Contig 013840:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011P01Sequence542005730 (4)gb:AY064024_15659632e-41Arabidopsis thaliana unknown protein (At2g47210) mRNA, complete cds.>gb:AY096610778013840 (2)gb:AY064024_15659636e-26Arabidopsis thaliana unknown protein (At2g47210) mRNA, complete cds.>gb:AY096610
JMSF049J15Sequence590000039 (2)gb:AB018109_15137520.010Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K17N15.>gb:AB047810_15728013840 (2)gb:AC104713_17378382e-11Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1362_G11, complete s

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF011P01+ TTGAAGCCAAAAGTCCCAACTAAACTNGTATGT
                      ____________________________________________________________
consensus TTGAAGCCAAAAGTCCCAACTAAACTNGTATGT
 
. : . : . : . : . : . :
rJMFF011P01+ GCTGAGCNCCTTGAACTTAGAAAAGAAATATTGACCCTTTTAAATATTCAGAAACAGTTG
                      ____________________________________________________________
consensus GCTGAGCNCCTTGAACTTAGAAAAGAAATATTGACCCTTTTAAATATTCAGAAACAGTTG
 
. : . : . : . : . : . :
rJMFF011P01+ CAATACAAGGAGGCCGAAGGTTCATCTTATCGTGATGGTTCATATTCTGAAACTCCTGGT
                      ____________________________________________________________
consensus CAATACAAGGAGGCCGAAGGTTCATCTTATCGTGATGGTTCATATTCTGAAACTCCTGGT
 
. : . : . : . : . : . :
rJMFF011P01+ TCACCGCCGAAGCGGTCACAGCGTGGAGTTGATCAGGATCGAACACTCACTCATGACTTA
                      ____________________________________________________________
consensus TCACCGCCGAAGCGGTCACAGCGTGGAGTTGATCAGGATCGAACACTCACTCATGACTTA
 
. : . : . : . : . : . :
rJMFF011P01+ AGTTTTGGAGGCGAAAGAGTTGGTAAAAGGGATCAAAAACGGAAGACACCTGGAACTCCC
rJMSF049J15+ GAAGACACCTGGAACTCCC
                      ____________________________________________________________
consensus AGTTTTGGAGGCGAAAGAGTTGGTAAAAGGGATCAAAAACGGAAGACACCTGGAACTCCC
 
. : . : . : . : . : . :
rJMFF011P01+ AAATTTGAAAGCTCACCAGCAACCTCAAAACGGCCACGGAAGTTGAAATCTTCAGATGGA
rJMSF049J15+ AAATTTGAAAGCTCACCAGCAACCTCAAAACGGCCNCGGAAGTTGAAATCTTCAGATGGA
                      ____________________________________________________________
consensus AAATTTGAAAGCTCACCAGCAACCTCAAAACGGCCACGGAAGTTGAAATCTTCAGATGGA
 
. : . : . : . : . : . :
rJMFF011P01+ TAGGCTTGGCAGGTGGGAGAAGAGAATTTAATTATTTTTGAAAGAGCGTTGGAGGGAGTC
rJMSF049J15+ TAGGCTTGGCAGGTGGGAGAAGAGAATTTAATTATTTTTGAAAGAGCGTTGGAGGGAGTC
                      ____________________________________________________________
consensus TAGGCTTGGCAGGTGGGAGAAGAGAATTTAATTATTTTTGAAAGAGCGTTGGAGGGAGTC
 
. : . : . : . : . : . :
rJMFF011P01+ CAGAAAAGTAAAGAAAATGGGTGGTGTTGCAGAAGCAGCAGCTACTAGTCAAGAAAGGGG
rJMSF049J15+ CAGAAAAGTAAAGAAAATGGGTGGTGTTGCAGAAGCAGCAGCTACTAGTCAAGAAAGGGG
                      ____________________________________________________________
consensus CAGAAAAGTAAAGAAAATGGGTGGTGTTGCAGAAGCAGCAGCTACTAGTCAAGAAAGGGG
 
. : . : . : . : . : . :
rJMFF011P01+ TCGCTGGTTGAGTTGAGGTGTGCAGAGACGAATGTGGAGGCAGCAGGGTAAGAAAAATGA
rJMSF049J15+ TCGCTGGTTGAGTTGAGGTGTGCAGAGACGAATGTGGAGGCAGCAGGGTAAGAAAAATGA
                      ____________________________________________________________
consensus TCGCTGGTTGAGTTGAGGTGTGCAGAGACGAATGTGGAGGCAGCAGGGTAAGAAAAATGA
 
. : . : . : . : . : . :
rJMFF011P01+ CTTTAGATCAGAAAAATCGTGCTACAATAGTGAAGTCTGAGAAGCACCCATAAAAGAGGG
rJMSF049J15+ CTTTAGATCAGAAAAATCGTGCTACAATAGTGAAGTCTGAGAAGCACCCATAAAAGAGGG
                      ____________________________________________________________
consensus CTTTAGATCAGAAAAATCGTGCTACAATAGTGAAGTCTGAGAAGCACCCATAAAAGAGGG
 
. : . : . : . : . : . :
rJMFF011P01+ GGAAATGAAAGATTATTGAAGTAAACATTGAATCTCAAATTCCAGGTGAAGAAGAATGGC
rJMSF049J15+ GGAAATGAAAGATTATTGAAGTAAACATTGAATCTCAAATTCCAGGTGAAGAAGAATGGC
                      ____________________________________________________________
consensus GGAAATGAAAGATTATTGAAGTAAACATTGAATCTCAAATTCCAGGTGAAGAAGAATGGC
 
. : . : . : . : . : . :
rJMFF011P01+ TTTTTTTTGTTGGGTTTCTTATTGATTTTGTCTGTTTTGTTGTATTGC-TTATTACTTCT
rJMSF049J15+ TTTTTTTTGTTGGGTTTCTTATTGATTTTGTCTGTTTTGTTGTANTGCACTATTACTTCT
                      ____________________________________________________________
consensus TTTTTTTTGTTGGGTTTCTTATTGATTTTGTCTGTTTTGTTGTATTGCATTATTACTTCT
 
. : . : . : . : . : . :
rJMFF011P01+ TCTCC-TATAC-TATACAATTGGGGATATGGAGGAGCTTTGATGCAAGATTTTGATTGTT
rJMSF049J15+ TCTCCNCATACGTATACAATTGGGGATATGGAGGAGCTCTGANGCAAGNTNTTGATTGTT
                      ____________________________________________________________
consensus TCTCCNTATACGTATACAATTGGGGATATGGAGGAGCTTTGATGCAAGATTTTGATTGTT
 
. : . : . : . : . : . :
rJMFF011P01+ AAGAGGATTCAAGCAAC
rJMSF049J15+ AAGAGGATTCAAGCAACCTNATNTGAAGATNCATGTCTCACAAAAGTGAATGNCCAAAAC
                      ____________________________________________________________
consensus AAGAGGATTCAAGCAACCTNATNTGAAGATNCATGTCTCACAAAAGTGAATGNCCAAAAC