Previous Contig 013838:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF049J13Sequence695007933 (3)pir|T01931|T019313e-62adenylyl cyclase - common tobacco>gb:AF026389_1762187 Nicotiana tabacum adenyl c765013838 (2)pir|T01931|T019313e-61adenylyl cyclase - common tobacco>gb:AF026389_1762187 Nicotiana tabacum adenyl c
JMSF051L13Sequence695007933 (3)pir|T01931|T019318e-62adenylyl cyclase - common tobacco>gb:AF026389_1762187 Nicotiana tabacum adenyl c750013838 (2)pir|T01931|T019313e-68adenylyl cyclase - common tobacco>gb:AF026389_1762187 Nicotiana tabacum adenyl c

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF051L13+ CTCATGGTAGATATTATGAGACTCGTGCAGAAGAA
                      ____________________________________________________________
consensus CTCATGGTAGATATTATGAGACTCGTGCAGAAGAA
 
. : . : . : . : . : . :
rJMSF051L13+ TGATTTACCTCTACAGCCAGGAACTGCAGATTTAGTTTTGAGGGTTTGTTATGAAAATGA
rJMSF049J13+ GCCAGGAACTGCAGATTTAGTTTTGAGGGTTTGTTATGAAAATGA
                      ____________________________________________________________
consensus TGATTTACCTCTACAGCCAGGAACTGCAGATTTAGTTTTGAGGGTTTGTTATGAAAATGA
 
. : . : . : . : . : . :
rJMSF051L13+ TAAGTGGGAGTTAATGTGTAAGTATGGAAAAAGATTTACCAAGGCAGGAGTAAAGTTGCG
rJMSF049J13+ TAAGTGGGAGTTAATGTGTAAGTATGGAAAAAGATTTACCAAGGCAGGAGTAAAGTTGCG
                      ____________________________________________________________
consensus TAAGTGGGAGTTAATGTGTAAGTATGGAAAAAGATTTACCAAGGCAGGAGTAAAGTTGCG
 
. : . : . : . : . : . :
rJMSF051L13+ TCAGGCTTCATTTGACTTGTGGATGGAATTTGCTGCAAAAATGGGAGATGTTGATTCTCT
rJMSF049J13+ TCAGGCTTCATTTGACTTGTGGATGGAATTTGCTGCAAAAATGGGAGATGTTGATTCTCT
                      ____________________________________________________________
consensus TCAGGCTTCATTTGACTTGTGGATGGAATTTGCTGCAAAAATGGGAGATGTTGATTCTCT
 
. : . : . : . : . : . :
rJMSF051L13+ TTGGAAAATTGAGAAGATAAGATCAGAATCCATGAAACATCACACAATTTCCAGTGCATT
rJMSF049J13+ TTGGAAAATTGAGAAGATAAGATCAGAATCCATGAAACATCACACAATTTCCAGTGCATT
                      ____________________________________________________________
consensus TTGGAAAATTGAGAAGATAAGATCAGAATCCATGAAACATCACACAATTTCCAGTGCATT
 
. : . : . : . : . : . :
rJMSF051L13+ TTCATGTGCTAAGGGTTTGTTGATTGGTCACAAACCTGAAGAAGCTGCTGCAATCATTCA
rJMSF049J13+ TTCATGTGCTAAGGGTTTGTTGATTGGTCACAAACCTGAAGAAGCTGCTGCAATCATTCA
                      ____________________________________________________________
consensus TTCATGTGCTAAGGGTTTGTTGATTGGTCACAAACCTGAAGAAGCTGCTGCAATCATTCA
 
. : . : . : . : . : . :
rJMSF051L13+ AGTATTTTATGAGAGTTTACCTGACTCGAAGAGGGCAAGTATTGTGGCTGAACTTCAAAA
rJMSF049J13+ AGTATTTTATGAGAGTTTACCTGACTCGAAGAGGGCAAGTATTGTGGCTGAACTTCAAAA
                      ____________________________________________________________
consensus AGTATTTTATGAGAGTTTACCTGACTCGAAGAGGGCAAGTATTGTGGCTGAACTTCAAAA
 
. : . : . : . : . : . :
rJMSF051L13+ GCTAGCAACTGAGTGGCCTTTGGAAGTTCTAAAGCGTCAAAAGGAGGAGAGCAGAAAGGA
rJMSF049J13+ GCTAGCAACTGAGTGGCCTTTGGAAGTTCTAAAGCGTCAAAAGGAGGAGAGCAGAAAGGA
                      ____________________________________________________________
consensus GCTAGCAACTGAGTGGCCTTTGGAAGTTCTAAAGCGTCAAAAGGAGGAGAGCAGAAAGGA
 
. : . : . : . : . : . :
rJMSF051L13+ ATTGGCTAGCACTCTACAAAATGGTGTTCCTGCCATGATCAATGCACTATCAAGCATAGG
rJMSF049J13+ ATTGGCTAGCACTCTACAAAATGGTGTTCCTGCCATGATCAATGCACTATCAAGCATAGG
                      ____________________________________________________________
consensus ATTGGCTAGCACTCTACAAAATGGTGTTCCTGCCATGATCAATGCACTATCAAGCATAGG
 
. : . : . : . : . : . :
rJMSF051L13+ CGCAAATGTGAAAGTAAATATGGAAGATCTGAGCAGAGAAGGTGTGTTGTCTTGACCAAG
rJMSF049J13+ CGCAAATGTGAAAGTAAATATGGAAGATCTGAGCAGAGAAGGTGTGTTGTCTTGACCAAG
                      ____________________________________________________________
consensus CGCAAATGTGAAAGTAAATATGGAAGATCTGAGCAGAGAAGGTGTGTTGTCTTGACCAAG
 
. : . : . : . : . : . :
rJMSF051L13+ GGAACA-TTTGCGGTCATTTGACGTCTCATATTCTATACTTGGTATTGGTATACTGGAGA
rJMSF049J13+ GGAACATTTTGCGGTCATTTGACGTCTCATATTCTATACTTGGTATTGGTATACTGGAGA
                      ____________________________________________________________
consensus GGAACATTTTGCGGTCATTTGACGTCTCATATTCTATACTTGGTATTGGTATACTGGAGA
 
. : . : . : . : . : . :
rJMSF051L13+ ATCAGCAACTACTAGGAAGCATGCCGCAGTTGACCTCTCTTTGCAAAAGATGCAAACCTT
rJMSF049J13+ ATCAGCAACTACTAGGAAGCATGCCGCAGTTGACCTCTCTTTGCAAAAGATGCAAACCTT
                      ____________________________________________________________
consensus ATCAGCAACTACTAGGAAGCATGCCGCAGTTGACCTCTCTTTGCAAAAGATGCAAACCTT
 
. : . : . : . : . : . :
rJMSF051L13+ TATAGGCTTCTACTTGACTTAAGAACACTTATTATTAGTTTTATCATTTGAGGCTC
rJMSF049J13+ TATAGGCTTCTACTTGACTTAAGAACACTTATTATTAGTTTTATCATTTGAGGCTCTGTA
                      ____________________________________________________________
consensus TATAGGCTTCTACTTGACTTAAGAACACTTATTATTAGTTTTATCATTTGAGGCTCTGTA
 
. : . : . : . : . : . :
rJMSF049J13+ TCAATCTTTCAATCTTTTAAAACTTCCAGTTTTGACTCTGAAAGTTTGGTGTTCTAAGGT
                      ____________________________________________________________
consensus TCAATCTTTCAATCTTTTAAAACTTCCAGTTTTGACTCTGAAAGTTTGGTGTTCTAAGGT