Previous Contig 013836:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF049J05Sequence669007932 (2)751013836 (2)gb:BT006486_16393735e-64Arabidopsis thaliana At5g49760 gene, complete cds.>gb:AK117123_1815170 Arabidops
JMSF052O13Sequence699007932 (2)923013836 (2)gb:BT006486_16393735e-93Arabidopsis thaliana At5g49760 gene, complete cds.>gb:AK117123_1815170 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052O13+ CCAGGGGA
                      ____________________________________________________________
consensus CCAGGGGA
 
. : . : . : . : . : . :
rJMSF052O13+ GNTAGTTGCCATCAAACGAGCTCAGCAGGGATCATTGCAGGGAGCATTAGAGTTCAAAAA
                      ____________________________________________________________
consensus GNTAGTTGCCATCAAACGAGCTCAGCAGGGATCATTGCAGGGAGCATTAGAGTTCAAAAA
 
. : . : . : . : . : . :
rJMSF052O13+ CAGAAATTGAGCTTCTGTCCAGAATTCACCATAAGAATGTAGTCAACCTTGTGGGGTTCT
                      ____________________________________________________________
consensus CAGAAATTGAGCTTCTGTCCAGAATTCACCATAAGAATGTAGTCAACCTTGTGGGGTTCT
 
. : . : . : . : . : . :
rJMSF052O13+ GTTATGAGCAAGGTGAACAAATGCTTGTTTATGAGTACATTCCAAATGGTACTCTAAGGG
                      ____________________________________________________________
consensus GTTATGAGCAAGGTGAACAAATGCTTGTTTATGAGTACATTCCAAATGGTACTCTAAGGG
 
. : . : . : . : . : . :
rJMSF052O13+ AAAGCCTTTCAGGAAAGTCTGGTTTTCAATTAAATTGGACGAGGAGACTGAAAATAGCCC
rJMSF049J05+ TTAAATTGGACGAGGAGACTGAAAATAGCCC
                      ____________________________________________________________
consensus AAAGCCTTTCAGGAAAGTCTGGTTTTCAATTAAATTGGACGAGGAGACTGAAAATAGCCC
 
. : . : . : . : . : . :
rJMSF052O13+ TTGATGCTGCCAGAGGGTTGGCTTATTTACACGAGCTCGCTGATCCTCCTATCATACACA
rJMSF049J05+ TTGATGCTGCCAGAGGGTTGGCTTATTTACACGAGCTCGCTGATCCTCCTATCATACACA
                      ____________________________________________________________
consensus TTGATGCTGCCAGAGGGTTGGCTTATTTACACGAGCTCGCTGATCCTCCTATCATACACA
 
. : . : . : . : . : . :
rJMSF052O13+ GAGATGTTAAGTCCAGTAACATTTTGTTGGATGATAATTTGAATGCTGAAGTTGCAGATT
rJMSF049J05+ GAGATGTTAAGTCCAGTAACATTTTGTTGGATGATAATTTGAATGCTGAAGTTGCAGATT
                      ____________________________________________________________
consensus GAGATGTTAAGTCCAGTAACATTTTGTTGGATGATAATTTGAATGCTGAAGTTGCAGATT
 
. : . : . : . : . : . :
rJMSF052O13+ TTGGCATTTCAAAACTTTTGGGAGATTCTGACAAGGGCCATGTCAGCACTCAAGTCAAAG
rJMSF049J05+ TTGGCATTTCAAAACTTTTGGGAGATTCTGACAAGGGCCATGTCAGCACTCAAGTCAAAG
                      ____________________________________________________________
consensus TTGGCATTTCAAAACTTTTGGGAGATTCTGACAAGGGCCATGTCAGCACTCAAGTCAAAG
 
. : . : . : . : . : . :
rJMSF052O13+ GCACATTTGGATACCTCGACCCTGAATACTACATGACTCAGCAGCTAACAGATAGAAGCG
rJMSF049J05+ GCACATTTGGATACCTCGACCCTGAATACTACATGACTCAGCAGCTAACAGATAGAAGCG
                      ____________________________________________________________
consensus GCACATTTGGATACCTCGACCCTGAATACTACATGACTCAGCAGCTAACAGATAGAAGCG
 
. : . : . : . : . : . :
rJMSF052O13+ ATGTATACAGCTTCGGAGTGGTCCTGTTGGAGCTCATAACTGCAAAACCTCCTATAGAAC
rJMSF049J05+ ATGTATACAGCTTCGGAGTGGTCCTGTTGGAGCTCATAACTGCAAAACCTCCTATAGAAC
                      ____________________________________________________________
consensus ATGTATACAGCTTCGGAGTGGTCCTGTTGGAGCTCATAACTGCAAAACCTCCTATAGAAC
 
. : . : . : . : . : . :
rJMSF052O13+ GAGGAAACCATATAGTGAAAGTGGTGTCTGAAGCAATGGATGATCAAAGCAATAGTAGAA
rJMSF049J05+ GAGGAAACCATATAGTGAAAGTGGTGTCTGAAGCAATGGATGATCAAAGCAATAGTAGAA
                      ____________________________________________________________
consensus GAGGAAACCATATAGTGAAAGTGGTGTCTGAAGCAATGGATGATCAAAGCAATAGTAGAA
 
. : . : . : . : . : . :
rJMSF052O13+ AACTTGATCAGGTGATAGATGTGATTCTCACACCTTGTACAAACCTTAAGGGCCTGCAGA
rJMSF049J05+ AACTTGATCAGGTGATAGATGTGATTCTCACACCTTGTACAAACCTTAAGGGCCTGCAGA
                      ____________________________________________________________
consensus AACTTGATCAGGTGATAGATGTGATTCTCACACCTTGTACAAACCTTAAGGGCCTGCAGA
 
. : . : . : . : . : . :
rJMSF052O13+ AGTTTATGAACTTGGCCATGAGTTGTGTACGAGAATCTGCAGCGGAGAGGCCTTCAATGG
rJMSF049J05+ AGTTTATGAACTTGGCCATGAGTTGTGTACGAGAATCTGCAGCGGAGAGGCCTTCAATGG
                      ____________________________________________________________
consensus AGTTTATGAACTTGGCCATGAGTTGTGTACGAGAATCTGCAGCGGAGAGGCCTTCAATGG
 
. : . : . : . : . : . :
rJMSF052O13+ GGGAGGTGGTGAGGGAGATTGAGAATATCATTCAGATGGCTGAGGAAGTACTATTCACTT
rJMSF049J05+ GGGAGGTGGTGAGGGAGATTGAGAATATCATTCAGATGGCTGAGGAAGTACTATTCACTT
                      ____________________________________________________________
consensus GGGAGGTGGTGAGGGAGATTGAGAATATCATTCAGATGGCTGAGGAAGTACTATTCACTT
 
. : . : . : . : . : . :
rJMSF052O13+ CATCTTCTAGCTTTGATGGTATTGATGACAGTTGGAATAGTAACTTACTTTGACAAACAC
rJMSF049J05+ CATCTTCTAGCTTTGATGGTATTGATGACAGTTGGAATAGTAACTTACTTTGACAAACAC
                      ____________________________________________________________
consensus CATCTTCTAGCTTTGATGGTATTGATGACAGTTGGAATAGTAACTTACTTTGACAAACAC
 
. : . : . : . : . : . :
rJMSF052O13+ TATGAACACAAAATCACTTTAATACATTCTCACACCCACACACAAATTGCAATTACATTT
rJMSF049J05+ TATGAACACAAAATCACTTTAATACATTCTCACACCCACACACAAATTGCAATTACATTT
                      ____________________________________________________________
consensus TATGAACACAAAATCACTTTAATACATTCTCACACCCACACACAAATTGCAATTACATTT
 
. : . : . : . : . : . :
rJMSF052O13+ GTAATATAAACTAAA
rJMSF049J05+ GTAATATAAACTAAATGTTTGAAATTTATATAGTTAATGGTTGCTTGAGGCCAGTTCAAG
                      ____________________________________________________________
consensus GTAATATAAACTAAATGTTTGAAATTTATATAGTTAATGGTTGCTTGAGGCCAGTTCAAG