Previous Contig 013827:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF014H10Sequence564007916 (5)gb:AY049262_15619042e-09Arabidopsis thaliana T4M14_7/T4M14_7 mRNA, partial cds.790013827 (2)gb:AB120525_15279673e-14Nicotiana tabacum HMA8 mRNA for hypothetical protein, partial cds, clone: KM10.
JMSF049G04Sequence683007916 (5)gb:AY487211_16085632e-18Arabidopsis thaliana isolate Cul_1 disease resistance protein RPP13 variant gene718013827 (2)gb:AX076881_14606696e-09Sequence 2 from Patent WO0107635.>gb:AX076883_1460670 Sequence 4 from Patent WO0

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF014H10+ GAATGACGGGA
                      ____________________________________________________________
consensus GAATGACGGGA
 
. : . : . : . : . : . :
rJMSF014H10+ GGAACTTCAACACCTTCCTCAAAAGTATGAATTTCCAACGAACCTAACAAAGCTGACCCT
                      ____________________________________________________________
consensus GGAACTTCAACACCTTCCTCAAAAGTATGAATTTCCAACGAACCTAACAAAGCTGACCCT
 
. : . : . : . : . : . :
rJMSF014H10+ GTCAAAGACCTACCTCCCATGGTGTGAATTGTCTGTGTTGGGAACACTAGAGAAACTTGA
                      ____________________________________________________________
consensus GTCAAAGACCTACCTCCCATGGTGTGAATTGTCTGTGTTGGGAACACTAGAGAAACTTGA
 
. : . : . : . : . : . :
rJMSF014H10+ AATCCTCAAGTTGATTGAGCATGCAGTTGTAGGAGAGTATTGGGAGCCAATCATTGGTGG
rJMSF049G04+ TCCTCAAGTTGATTGAGCATGCAGTTGTAGGAGAGTATTGGGAGCCAATCATTGGTGG
                      ____________________________________________________________
consensus AATCCTCAAGTTGATTGAGCATGCAGTTGTAGGAGAGTATTGGGAGCCAATCATTGGTGG
 
. : . : . : . : . : . :
rJMSF014H10+ TTTTCTTTGTCTTCAGGTCTTGCATATTGAGAGGACCGACTTAAGGTCCTTGAAAGCTTC
rJMSF049G04+ TTTTCTTTGTCTTCAGGTCTTGCATATTGAGAGGACCGACTTAAGGTCCTTGAAAGCTTC
                      ____________________________________________________________
consensus TTTTCTTTGTCTTCAGGTCTTGCATATTGAGAGGACCGACTTAAGGTCCTTGAAAGCTTC
 
. : . : . : . : . : . :
rJMSF014H10+ AAATAAACACTTCCCAAGACTCAAGAGCCTTGCTCTTAGGCACTGTGAGAAGCTTGAGGC
rJMSF049G04+ AAATAAACACTTCCCAAGACTCAAGAGCCTTGCTCTTAGGCACTGTGAGAAGCTTGAGGC
                      ____________________________________________________________
consensus AAATAAACACTTCCCAAGACTCAAGAGCCTTGCTCTTAGGCACTGTGAGAAGCTTGAGGC
 
. : . : . : . : . : . :
rJMSF014H10+ GATCCCACTTGCCCTGGCTGATATAAGCAGTCTAGAGATAGACTTGAACCATAGCAAGAT
rJMSF049G04+ GATCCCACTTGCCCTGGCTGATATAAGCAGTCTAGAGATAGACTTGAACCATAGCAAGAT
                      ____________________________________________________________
consensus GATCCCACTTGCCCTGGCTGATATAAGCAGTCTAGAGATAGACTTGAACCATAGCAAGAT
 
. : . : . : . : . : . :
rJMSF014H10+ GGCAATCCCGTCTGCACAAGATATACTCAAGCAGAAACAGCAGAAACAGGACCCAACCGA
rJMSF049G04+ GGCAATCCCGTCTGCACAAGATATACTCAAGCAGAAACAGCAGAAACAGGACCCAACCGA
                      ____________________________________________________________
consensus GGCAATCCCGTCTGCACAAGATATACTCAAGCAGAAACAGCAGAAACAGGACCCAACCGA
 
. : . : . : . : . : . :
rJMSF014H10+ AAAACCCACCCATAGATTCAAGCTCACTATCTATCCTCCTTTGGATCCTTCTCAAGCAAG
rJMSF049G04+ AAAACCCACCCATAGATTCAAGCTCACTATCTATCCTCCTTTGGATCCTTCTCAAGCAAG
                      ____________________________________________________________
consensus AAAACCCACCCATAGATTCAAGCTCACTATCTATCCTCCTTTGGATCCTTCTCAAGCAAG
 
. : . : . : . : . : . :
rJMSF014H10+ CTAGCTTTGGCAGGTGTACTGTTCAACTCTACGGAGTATTATTTATTTTATTTTCTATTG
rJMSF049G04+ CTAGCTTTGGCAGGTGTACTGTTCAACTCTACGGAGTATTATTTATTTTATTTTCTATTG
                      ____________________________________________________________
consensus CTAGCTTTGGCAGGTGTACTGTTCAACTCTACGGAGTATTATTTATTTTATTTTCTATTG
 
. : . : . : . : . : . :
rJMSF014H10+ GTGTGAAGTCATAACGCATTGGAGGCTACTATTCCTACCCAGGAAGCTGTTTGATTTTGT
rJMSF049G04+ GTGTGAAGTCATAACGCATTGGAGGCTACTATTCCTACCCAGGAAGCTGTTTGATTTTGT
                      ____________________________________________________________
consensus GTGTGAAGTCATAACGCATTGGAGGCTACTATTCCTACCCAGGAAGCTGTTTGATTTTGT
 
. : . : . : . : . : . :
rJMSF014H10+ CCATGCATGTTAGCAAAGACGACCAGGAGAGTCTACTCTCAATACTTAGCTAGCAGATGT
rJMSF049G04+ CCATGCATGTTAGCAAAGACGACCAGGAGAGTCTACTCTCAATACTTAGCTAGCAGATGT
                      ____________________________________________________________
consensus CCATGCATGTTAGCAAAGACGACCAGGAGAGTCTACTCTCAATACTTAGCTAGCAGATGT
 
. : . : . : . : . : . :
rJMSF014H10+ TTTAAGGGTTGTTGACAATGAGATCGAACCATTTTGAAGCTGTTGTTAAGGTAAAATTAA
rJMSF049G04+ TTTAAGGGTTGTTGACAATGAGATCGAACCATTTTGAAGCTGTTGTTAAGGTAAAATTAA
                      ____________________________________________________________
consensus TTTAAGGGTTGTTGACAATGAGATCGAACCATTTTGAAGCTGTTGTTAAGGTAAAATTAA
 
. : . : . : . : . : . :
rJMSF014H10+ GATTCATGACCTTATCATTTGTGAGCTGAGCTGCTTGAAAGTAAAGTATGTCTTCAAGA
rJMSF049G04+ GATTCATGACCTTATCATTTGTGAGCTGAGCTGCTTGAAAGTAAAGTATGTCTTCAAGAT
                      ____________________________________________________________
consensus GATTCATGACCTTATCATTTGTGAGCTGAGCTGCTTGAAAGTAAAGTATGTCTTCAAGAT
 
. : . : . : . : . : . :
rJMSF049G04+ GATGTTTTCAATTAAGTCCCTTCATATTATAATTAACTACCAATGGATCTGTTATTGGTT
                      ____________________________________________________________
consensus GATGTTTTCAATTAAGTCCCTTCATATTATAATTAACTACCAATGGATCTGTTATTGGTT