Previous Contig 013821:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026O06Sequence207013821 (2)gb:AF360323_17912692e-30Arabidopsis thaliana unknown protein (At3g02720) mRNA, partial cds.
JMSF049E10Sequence646004573 (3)723013821 (2)gb:AF360323_17912693e-95Arabidopsis thaliana unknown protein (At3g02720) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF049E10+ GCA
                      ____________________________________________________________
consensus GCA
 
. : . : . : . : . : . :
rJMSF049E10+ CTCGGGGGCAACATAACTGGCTCTGGCAAAAGAATTCTGTTTCTCTGTGGGGATTTTATG
                      ____________________________________________________________
consensus CTCGGGGGCAACATAACTGGCTCTGGCAAAAGAATTCTGTTTCTCTGTGGGGATTTTATG
 
. : . : . : . : . : . :
rJMSF049E10+ GAAGATTATGAGGTGGCGGTTCCTTTCCAGACCCTCCAAGCACTTGAGTGTCGAGTCGAA
                      ____________________________________________________________
consensus GAAGATTATGAGGTGGCGGTTCCTTTCCAGACCCTCCAAGCACTTGAGTGTCGAGTCGAA
 
. : . : . : . : . : . :
rJMSF049E10+ TCTGTTTGTCCTAAGAAAAAAGCAGGCGAAAAATGCCCAACGGCTGTTCATGACTTTGAA
                      ____________________________________________________________
consensus TCTGTTTGTCCTAAGAAAAAAGCAGGCGAAAAATGCCCAACGGCTGTTCATGACTTTGAA
 
. : . : . : . : . : . :
rJMSF049E10+ GGCGACCAAACATATAGCGAGAAGCCCGGTCATGACTTCGTCCTAAATTCTAGTTTCGAA
                      ____________________________________________________________
consensus GGCGACCAAACATATAGCGAGAAGCCCGGTCATGACTTCGTCCTAAATTCTAGTTTCGAA
 
. : . : . : . : . : . :
rJMSF049E10+ GATGTTAGCAGCGCTTCGAGCTATGATGGGCTTGTTATTCCTGGTGGCAGAGCCCCAGAA
                      ____________________________________________________________
consensus GATGTTAGCAGCGCTTCGAGCTATGATGGGCTTGTTATTCCTGGTGGCAGAGCCCCAGAA
 
. : . : . : . : . : . :
rJMFF026O06+ AAA
rJMSF049E10+ TATCTGGCACTGGACAACGATGTTATCAAATTGGTGAAGGAGTTCATGGAATCTAAGAAA
                      ____________________________________________________________
consensus TATCTGGCACTGGACAACGATGTTATCAAATTGGTGAAGGAGTTCATGGAATCTAAGAAA
 
. : . : . : . : . : . :
rJMFF026O06+ CCCGTTGCATCAATCTNCCATGGCCAACAGATTCTGGCTGNTGCAGGCGTTCTCAAGGGT
rJMSF049E10+ CCCGTTGCATCAATCTGCCATGGCCAACAGATTCTGGCTGCTGCAGGCGTTCTCAAGGGT
                      ____________________________________________________________
consensus CCCGTTGCATCAATCTGCCATGGCCAACAGATTCTGGCTGCTGCAGGCGTTCTCAAGGGT
 
. : . : . : . : . : . :
rJMFF026O06+ AAGAAGTGCACTGCATACCCCGCGGTGAAACTCAACGTGGTTNTTGGAGGGGCGACATGG
rJMSF049E10+ AAGAAGTGCACTGCATACCCCGCGGTGAAACTCAACGTGGTTCTTGGAGGGGCGACATGG
                      ____________________________________________________________
consensus AAGAAGTGCACTGCATACCCCGCGGTGAAACTCAACGTGGTTCTTGGAGGGGCGACATGG
 
. : . : . : . : . : . :
rJMFF026O06+ TTAGAGCCAGAGCCGATAGATCGTTGCTTCACTGATGGAAATCTGGTGACAGGCGCGGCT
rJMSF049E10+ TTAGAGCCAGAGCCGATAGATCGTTGCTTCACTGATGGAAATCTGGTGACAGGCGCGGCT
                      ____________________________________________________________
consensus TTAGAGCCAGAGCCGATAGATCGTTGCTTCACTGATGGAAATCTGGTGACAGGCGCGGCT
 
. : . : . : . : . : . :
rJMFF026O06+ NGGCCAGGCCATCCCGAGTTCATT
rJMSF049E10+ TGGCCAGGCCATCCCGAGTTCATTTCTCAGTTCATGGCACTGCTTGGAGTGCGTGTAGCG
                      ____________________________________________________________
consensus TGGCCAGGCCATCCCGAGTTCATTTCTCAGTTCATGGCACTGCTTGGAGTGCGTGTAGCG
 
. : . : . : . : . : . :
rJMSF049E10+ TTCTAAGTTTGCGGTATGCGTTCTATGATGTCTCATATCTCCTTACCTTTACATGAACCC
                      ____________________________________________________________
consensus TTCTAAGTTTGCGGTATGCGTTCTATGATGTCTCATATCTCCTTACCTTTACATGAACCC
 
. : . : . : . : . : . :
rJMSF049E10+ AATTAAAAGAAGGGCTAGTGTGAAACTTTCAATGACGCCTGTCTCTATCTGAACAAAAGA
                      ____________________________________________________________
consensus AATTAAAAGAAGGGCTAGTGTGAAACTTTCAATGACGCCTGTCTCTATCTGAACAAAAGA