Previous Contig 013812:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF049C13Sequence691013812 (2)gb:AB006700_15098952e-62Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MHF15.>gb:AY050830_1562799013812 (2)gb:AB006700_15098952e-99Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MHF15.>gb:AY050830_1562

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF049C13- GGCTTCACT
                      ____________________________________________________________
consensus GGCTTCACT
 
. : . : . : . : . : . :
JMSF049C13- GCTATTCTCTCTCCCGGAGAGATGGGCAATTCTCCGTCGTCTTCTATCAATCCTCGCTTT
                      ____________________________________________________________
consensus GCTATTCTCTCTCCCGGAGAGATGGGCAATTCTCCGTCGTCTTCTATCAATCCTCGCTTT
 
. : . : . : . : . : . :
JMSF049C13- GCTTCCGCCAAAAGAGCGTTCACTGAGAAGGAACTAGAAGACCTTTACTCATTGTTCCTT
                      ____________________________________________________________
consensus GCTTCCGCCAAAAGAGCGTTCACTGAGAAGGAACTAGAAGACCTTTACTCATTGTTCCTT
 
. : . : . : . : . : . :
JMSF049C13- TCACTCGCCGAGAAATCTGAAAGAAATGCCCAGCACATCTCCCCTTCTGTTTTCAAGAAT
                      ____________________________________________________________
consensus TCACTCGCCGAGAAATCTGAAAGAAATGCCCAGCACATCTCCCCTTCTGTTTTCAAGAAT
 
. : . : . : . : . : . :
JMSF049C13- CACGTTGGAATTGAAGGGCCGCTGGGGGATAGATTGTTCGACTTGGCCTCTCAGAATCGC
                      ____________________________________________________________
consensus CACGTTGGAATTGAAGGGCCGCTGGGGGATAGATTGTTCGACTTGGCCTCTCAGAATCGC
 
. : . : . : . : . : . :
JMSF049C13- AAGGATCAAAAGCTTACCTTTGAAGATCTTGTTATTGCTAAAGCAACTTATGAAAAAGGA
                      ____________________________________________________________
consensus AAGGATCAAAAGCTTACCTTTGAAGATCTTGTTATTGCTAAAGCAACTTATGAAAAAGGA
 
. : . : . : . : . : . :
JMSF049C13- ACGAAAGATGAGATTGAAGAGTTCATCTATCAACTATTAGATGTCTCTGCTGATGGCACC
                      ____________________________________________________________
consensus ACGAAAGATGAGATTGAAGAGTTCATCTATCAACTATTAGATGTCTCTGCTGATGGCACC
 
. : . : . : . : . : . :
JMSF049C13- GTTGGAAGGTCTGATCTTGAAGCTGTTTTAACTGCAATGCTAGATAGTGTATTTTCTCAA
                      ____________________________________________________________
consensus GTTGGAAGGTCTGATCTTGAAGCTGTTTTAACTGCAATGCTAGATAGTGTATTTTCTCAA
 
. : . : . : . : . : . :
JMSF049C13- CAACATGGACCAGGTTCACATTCGGAAGTTATTGGCATACTCCTCAATGCTGCAAATTTC
                      ____________________________________________________________
consensus CAACATGGACCAGGTTCACATTCGGAAGTTATTGGCATACTCCTCAATGCTGCAAATTTC
 
. : . : . : . : . : . :
JMSF049C13- ACAACGGATAGTCAAAAACCGGCTGAGAGTTGTATGTCATATGAAGAGTTTAGAAAGTGG
rJMSF049C13+ TGAAGAGTTTAGAAAGTGG
                      ____________________________________________________________
consensus ACAACGGATAGTCAAAAACCGGCTGAGAGTTGTATGTCATATGAAGAGTTTAGAAAGTGG
 
. : . : . : . : . : . :
JMSF049C13- TGCGCACTTCTCCCATCTGTAAGGAAGTTCCTTGGAAGTTTGTTGATGCCATCTGATCCA
rJMSF049C13+ TGCGCACTTCTCCCATCTGTAAGGAAGTTCCTTGGAAGTTTGTTGATGCCATCTGATCCA
                      ____________________________________________________________
consensus TGCGCACTTCTCCCATCTGTAAGGAAGTTCCTTGGAAGTTTGTTGATGCCATCTGATCCA
 
. : . : . : . : . : . :
JMSF049C13- GGTTCTGATGTTCCTAGACTAGTGCACCAGGACAATATTAATTCTAATGTAATCTTGTTA
rJMSF049C13+ GGTTCTGATGTTCCTAGACTAGTGCACCAGGACAATATTAATTCTAATGTAATCTTGTTA
                      ____________________________________________________________
consensus GGTTCTGATGTTCCTAGACTAGTGCACCAGGACAATATTAATTCTAATGTAATCTTGTTA
 
. : . : . : . : . : . :
JMSF049C13- AGGAAGGAATATGCTTGGCTAA
rJMSF049C13+ AGGAAGGAATATGCTTGGCTAATTGGAGGTGCCCTCCCTCAAGAGGACCTGCATGAATGG
                      ____________________________________________________________
consensus AGGAAGGAATATGCTTGGCTAATTGGAGGTGCCCTCCCTCAAGAGGACCTGCATGAATGG
 
. : . : . : . : . : . :
rJMSF049C13+ AAACTTCTTTATCACAGTACAGTTCATGGCTTAAGCTTCAATACATTCTTGGGAAACGTA
                      ____________________________________________________________
consensus AAACTTCTTTATCACAGTACAGTTCATGGCTTAAGCTTCAATACATTCTTGGGAAACGTA
 
. : . : . : . : . : . :
rJMSF049C13+ TCGAATGACAAAGGTCCTTCTGTGTTAATTATCAAAGACAAAGAAGGTTATATATACGGA
                      ____________________________________________________________
consensus TCGAATGACAAAGGTCCTTCTGTGTTAATTATCAAAGACAAAGAAGGTTATATATACGGA
 
. : . : . : . : . : . :
rJMSF049C13+ GGTTATGCATCTCAGCCATGGGAGAGACACGCAGAATTTTATGGAGATATGAAATCGTTC
                      ____________________________________________________________
consensus GGTTATGCATCTCAGCCATGGGAGAGACACGCAGAATTTTATGGAGATATGAAATCGTTC
 
. : . : . : . : . : . :
rJMSF049C13+ ATCTTCCAACTTTACCCAAAAGCATCAATTTTCCGCCCCACTGGAGCAAACCACAATATA
                      ____________________________________________________________
consensus ATCTTCCAACTTTACCCAAAAGCATCAATTTTCCGCCCCACTGGAGCAAACCACAATATA
 
. : . : . : . : . : . :
rJMSF049C13+ CAGTGGTGTGCTGTAAATTTCAGTTCGGAGAGCATTCCTAATGGCATTGGTTTTGGAGGA
                      ____________________________________________________________
consensus CAGTGGTGTGCTGTAAATTTCAGTTCGGAGAGCATTCCTAATGGCATTGGTTTTGGAGGA
 
. : . : . : . : . : . :
rJMSF049C13+ AGAGTGAATCATTTTGGGTTGTTCATCCTAGCCAACTTCGATCAGGGCCATACTTTCCCA
                      ____________________________________________________________
consensus AGAGTGAATCATTTTGGGTTGTTCATCCTAGCCAACTTCGATCAGGGCCATACTTTCCCA
 
. : . : . : . : . : . :
rJMSF049C13+ TGCACTACATTTGGCAGCCCCAGCTTGTCAGCAAGCAATGTTATATATCCAGAAGCAATA
                      ____________________________________________________________
consensus TGCACTACATTTGGCAGCCCCAGCTTGTCAGCAAGCAATGTTATATATCCAGAAGCAATA
 
. : . : . : . : . : . :
rJMSF049C13+ GAGTGCTGGGGAGTCATCGTCAAGAAAGCTCAAGAAGAAACACAAGATCGCATCAAAGGA
                      ____________________________________________________________
consensus GAGTGCTGGGGAGTCATCGTCAAGAAAGCTCAAGAAGAAACACAAGATCGCATCAAAGGA
 
. : . : . : . : . : . :
rJMSF049C13+ ACCATACTTGAGAGATTTAAAGAAGATCGCCATATGCTTAACATGGTTGGGCTTGCCAAT
                      ____________________________________________________________
consensus ACCATACTTGAGAGATTTAAAGAAGATCGCCATATGCTTAACATGGTTGGGCTTGCCAAT
 
. : . : . : . : . : . :
rJMSF049C13+ TCAAGCGAGTGATCTTCCCTAATTTGTTTCTTTCCCTACATTGTTCCCTTACACTATAGA
                      ____________________________________________________________
consensus TCAAGCGAGTGATCTTCCCTAATTTGTTTCTTTCCCTACATTGTTCCCTTACACTATAGA