Previous Contig 013806:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF049B03Sequence612013806 (2)691013806 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF049B03- AAAACTCTCATCCATAGAAAAAGAGTGCGAAAACGAACGACCAGTCC
                      ____________________________________________________________
consensus AAAACTCTCATCCATAGAAAAAGAGTGCGAAAACGAACGACCAGTCC
 
. : . : . : . : . : . :
JMSF049B03- GTCCAAACCTAATTAGTCTGACCAAAGATTGAAAACTAAACTAAACTAACAGCTGGATCG
rJMSF049B03+ TGAAAACTAAACTAAACTAACAGCTGGATCG
                      ____________________________________________________________
consensus GTCCAAACCTAATTAGTCTGACCAAAGATTGAAAACTAAACTAAACTAACAGCTGGATCG
 
. : . : . : . : . : . :
JMSF049B03- GATCAGATCAGATCTGCGGTGCCCGATAACCAATCAATCAGTCTACTCCGATCTGATTAG
rJMSF049B03+ GATCAGATCAGATCTGCGGTGCCCGATAACCAATCAATCAGTCTACTCCGATCTGATTAG
                      ____________________________________________________________
consensus GATCAGATCAGATCTGCGGTGCCCGATAACCAATCAATCAGTCTACTCCGATCTGATTAG
 
. : . : . : . : . : . :
JMSF049B03- ACCAGACCAAAAAACTAAACTATCCTCAACGAACGCCTGCAGCGAATTGAAGTCTCCGTC
rJMSF049B03+ ACCAGACCAAAAAACTAAACTATCCTCAACGAACGCCTGCAGCGAATTGAAGTCTCCGTC
                      ____________________________________________________________
consensus ACCAGACCAAAAAACTAAACTATCCTCAACGAACGCCTGCAGCGAATTGAAGTCTCCGTC
 
. : . : . : . : . : . :
JMSF049B03- GTGGAGTCACCAGCAAAGCTGCCAGGCCAGCATATATGAAGAAGATCACACTAGCTAGCT
rJMSF049B03+ GTGGAGTCACCAGCAAAGCTGCCAGGCCAGCATATATGAAGAAGATCACACTAGCTAGCT
                      ____________________________________________________________
consensus GTGGAGTCACCAGCAAAGCTGCCAGGCCAGCATATATGAAGAAGATCACACTAGCTAGCT
 
. : . : . : . : . : . :
JMSF049B03- ACTACGAATGGCAACAAATATCTATCATATCATTGGCGTTTGATTTGCAGCTTACAACCC
rJMSF049B03+ ACTACGAATGGCAACAAATATCTATCATATCATTGGCGTTTGATTTGCAGCTTACAACCC
                      ____________________________________________________________
consensus ACTACGAATGGCAACAAATATCTATCATATCATTGGCGTTTGATTTGCAGCTTACAACCC
 
. : . : . : . : . : . :
JMSF049B03- TAAGCTAGTTAGTACGTCGTCGTATAATGTGCAGCAAACTGCGCGCATACGATTGTTGCC
rJMSF049B03+ TAAGCTAGTTAGTACGTCGTCGTATAATGTGCAGCAAACTGCGCGCATACGATTGTTGCC
                      ____________________________________________________________
consensus TAAGCTAGTTAGTACGTCGTCGTATAATGTGCAGCAAACTGCGCGCATACGATTGTTGCC
 
. : . : . : . : . : . :
JMSF049B03- TGCAATCAACGACAAGATATATATATATATATATATATGATGGCGATCGAGCTGAGGTAT
rJMSF049B03+ NGCAATCAACGACAAGATATATATATATATATATATATGATGGCGATCGAGCTGAGGTAT
                      ____________________________________________________________
consensus TGCAATCAACGACAAGATATATATATATATATATATATGATGGCGATCGAGCTGAGGTAT
 
. : . : . : . : . : . :
JMSF049B03- CGTGGATGGAAGGCGATCATATATATCGACGATGTGAGCTGATGATGAGACATGCATATA
rJMSF049B03+ CGTGGATGGAAGGCGATCATATATATCGACGATGTGAGCTGATGATGAGACATGCATATA
                      ____________________________________________________________
consensus CGTGGATGGAAGGCGATCATATATATCGACGATGTGAGCTGATGATGAGACATGCATATA
 
. : . : . : . : . : . :
JMSF049B03- TTTGATCGCCGCGCCGTCTCCTCCTCCGACCAAATCNGGTGAACACTGTACTATATAAAG
rJMSF049B03+ TTTGATCGCCGCGCCGTCTCCTCCTCCGACCAAATCAGGTGAACACTGTACTATATAAAG
                      ____________________________________________________________
consensus TTTGATCGCCGCGCCGTCTCCTCCTCCGACCAAATCAGGTGAACACTGTACTATATAAAG
 
. : . : . : . : . : . :
JMSF049B03- AAAGAGGGANAGAGATTATCTATCT
rJMSF049B03+ AAAGAGGGAAAGAGATTATCTATCTAGCTTAGCTTGCATGCACCAATAGCTGATGAGCTA
                      ____________________________________________________________
consensus AAAGAGGGAAAGAGATTATCTATCTAGCTTAGCTTGCATGCACCAATAGCTGATGAGCTA
 
. : . : . : . : . : . :
rJMSF049B03+ TCCACAAATGGAGGCCGGACTTTTGCATTTTGGCATTTTAGTTTTTCCATTGGCCCGATC
                      ____________________________________________________________
consensus TCCACAAATGGAGGCCGGACTTTTGCATTTTGGCATTTTAGTTTTTCCATTGGCCCGATC
 
. : . : . : . : . : . :
rJMSF049B03+ CTTTAATAGTGATATATGCATATATGGTTAATTAATAATTGATTATACGTGTAAAAATTC
                      ____________________________________________________________
consensus CTTTAATAGTGATATATGCATATATGGTTAATTAATAATTGATTATACGTGTAAAAATTC