Previous Contig 013800:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF038D11Sequence666007204 (9)gb:AY093141_15750953e-21Arabidopsis thaliana unknown protein (At5g58140) mRNA, complete cds.>gb:BT008901881013800 (2)gb:SOPRTKINB_1715842e-104S.oleracea mRNA for protein kinase.
JMSF048P12Sequence694007881 (2)gb:AY093141_15750954e-36Arabidopsis thaliana unknown protein (At5g58140) mRNA, complete cds.>gb:BT008901773013800 (2)gb:SOPRTKINB_17158421e-75S.oleracea mRNA for protein kinase.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF038D11+ CNGAGGAGAGTTATTTGCCCTGCNTGACAAGCAGCCCTCGAAAAATATTTAAAGAG
                      ____________________________________________________________
consensus CNGAGGAGAGTTATTTGCCCTGCNTGACAAGCAGCCCTCGAAAAATATTTAAAGAG
 
. : . : . : . : . : . :
rJMSF038D11+ GAATCTGCAAGGTTCTATGCGGCAGAAATTTTAATTGCCTTGGAATATCTTCATTGTTTA
                      ____________________________________________________________
consensus GAATCTGCAAGGTTCTATGCGGCAGAAATTTTAATTGCCTTGGAATATCTTCATTGTTTA
 
. : . : . : . : . : . :
rJMSF038D11+ GGAATAGTATACCGGGACCTGAAACCAGAAAACATTCTACTCCAGGCAAATGGACATGTT
                      ____________________________________________________________
consensus GGAATAGTATACCGGGACCTGAAACCAGAAAACATTCTACTCCAGGCAAATGGACATGTT
 
. : . : . : . : . : . :
rJMSF038D11+ GTGTTAACCGACTTTGATCTATCCTTCAAGACAACCTGTAAACTCCAAGTAATAAAACAC
                      ____________________________________________________________
consensus GTGTTAACCGACTTTGATCTATCCTTCAAGACAACCTGTAAACTCCAAGTAATAAAACAC
 
. : . : . : . : . : . :
rJMSF038D11+ CCTCCACCCAAAAGAAGGTCTAGGAGTACTCCACCACTGACATTTGTTGCAGAACCAACT
rJMSF048P12+ ACATTTGTTGCAGAACCAGTT
                      ____________________________________________________________
consensus CCTCCACCCAAAAGAAGGTCTAGGAGTACTCCACCACTGACATTTGTTGCAGAACCAGTT
 
. : . : . : . : . : . :
rJMSF038D11+ ACACAGTCAAATTCATTTGTGGGAACTGAAGAATACATTGCTCCGGAAATTATTACAGGT
rJMSF048P12+ TCGCAGTCGAATTCATTCGTTGGGACTGAAGAGTACATTGCTCCAGAAATTATAACCGGT
                      ____________________________________________________________
consensus TCGCAGTCGAATTCATTTGTTGGGACTGAAGAGTACATTGCTCCGGAAATTATTACCGGT
 
. : . : . : . : . : . :
rJMSF038D11+ GCAGGCCACAGCAGTGCTATTGATTGGTGGGCTTTAGGCGTTTTGATCTATGAGATGCTC
rJMSF048P12+ GCTGGTCACAGCAGTGCTATTGATTGGTGGGCTCTAGGTATTTTGCTGTATGAGATGTTG
                      ____________________________________________________________
consensus GCTGGTCACAGCAGTGCTATTGATTGGTGGGCTTTAGGTGTTTTGCTGTATGAGATGTTG
 
. : . : . : . : . : . :
rJMSF038D11+ TATGGGCGCACGCCATTTAGAGGAAAGAATAGGCAGAAGACATTTGCCAACATCTTAAAC
rJMSF048P12+ TATGGGCGCACGCCATTTAGAGGAAAGAATAGGCAAAAGACATTTGCCAACATCTTAAAC
                      ____________________________________________________________
consensus TATGGGCGCACGCCATTTAGAGGAAAGAATAGGCAGAAGACATTTGCCAACATCTTAAAC
 
. : . : . : . : . : . :
rJMSF038D11+ AAAGACCTCACATTCCCAAGTAGCGTTCCGGTAAGCCTGGCGGGGAGGCAGTTGATTCAT
rJMSF048P12+ AAAGATCTTACCTTCCCAAGCAGCATTCAGGTGAGCCTGGCTGCAAGGCAATTGATTCAC
                      ____________________________________________________________
consensus AAAGATCTTACCTTCCCAAGTAGCGTTCCGGTGAGCCTGGCTGGGAGGCAGTTGATTCAT
 
. : . : . : . : . : . :
rJMSF038D11+ GCCTTACTAAATAGAGATCCTGGGAGCCGTTTGGGATCGAATGGAGGTGCCAATGAGATA
rJMSF048P12+ GCATTGTTAAATAGAGATCCTGCATGCCGTTTGGGATCAAATAGCGGTGCAAATGAGATC
                      ____________________________________________________________
consensus GCCTTGTTAAATAGAGATCCTGGGTGCCGTTTGGGATCGAATGGCGGTGCCAATGAGATC
 
. : . : . : . : . : . :
rJMSF038D11+ AAACAGCACCCTTTCTTCTGCGGAATAAAATGGCCTCTGATCCGATGCATGAGCCCACCT
rJMSF048P12+ AAACAACATCCTTTCTTCCGGGAAATAAACTGGCCTCTCATCCGATGCATGAGCCCACCT
                      ____________________________________________________________
consensus AAACAGCATCCTTTCTTCTGGGGAATAAACTGGCCTCTGATCCGATGCATGAGCCCACCT
 
. : . : . : . : . : . :
rJMSF038D11+ CCATTAGAAGCACCTCTTAAGTTAATTGGAAAAGAAGCAAATGCAAAGGAAGTGGATTGG
rJMSF048P12+ CCACTAGACGCGCCTCTTCAGTTAATTGGAAAGGAAACAAACACTAATGATGTAGACTGG
                      ____________________________________________________________
consensus CCATTAGACGCGCCTCTTCAGTTAATTGGAAAGGAAGCAAATGCTAATGATGTGGATTGG
 
. : . : . : . : . : . :
rJMSF038D11+ GATGATGAGGGAGTTCTTGTTCATCACATGGACTTCTTCTAGA
rJMSF048P12+ AATGATGAGGGAGTGCTTGTTCATCCCATGGACTTCTTCTAGAGGGCTTTGTTTTCCCAA
                      ____________________________________________________________
consensus GATGATGAGGGAGTTCTTGTTCATCCCATGGACTTCTTCTAGAGGGCTTTGTTTTCCCAA
 
. : . : . : . : . : . :
rJMSF048P12+ GATGGGGACTTTGTTCTACTCTATGCATGAACTACTATATAATTGCATGTTCCCACAAAA
                      ____________________________________________________________
consensus GATGGGGACTTTGTTCTACTCTATGCATGAACTACTATATAATTGCATGTTCCCACAAAA
 
. : . : . : . : . : . :
rJMSF048P12+ GAGGAACATCATTAGACGAAGTTGAGGAGTTTTACATTGTACAGAGCTGATTTTAGCAAT
                      ____________________________________________________________
consensus GAGGAACATCATTAGACGAAGTTGAGGAGTTTTACATTGTACAGAGCTGATTTTAGCAAT
 
. : . : . : . : . : . :
rJMSF048P12+ GTTAATCTATATATACTCCATTTTTCTTCTTTCAAGCTTTATTTGGTTCTCCCTCTTCGA
                      ____________________________________________________________
consensus GTTAATCTATATATACTCCATTTTTCTTCTTTCAAGCTTTATTTGGTTCTCCCTCTTCGA
 
. : . : . : . : . : . :
rJMSF048P12+ AGGACTTGAAGAAGAGATGTAAAGTAGCCGGCAATAAACAGTAGATATCCACTACCGTCT
                      ____________________________________________________________
consensus AGGACTTGAAGAAGAGATGTAAAGTAGCCGGCAATAAACAGTAGATATCCACTACCGTCT