Previous Contig 013797:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF048O04Sequence634013797 (2)665013797 (2)gb:ATAC012395_15434630.002Arabidopsis thaliana chromosome III BAC T1B9 genomic sequence, complete sequence

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF048O04- GGGCTTTCCTTCCCATTTCGCGTGCATTTCCCGAACCCT
                      ____________________________________________________________
consensus GGGCTTTCCTTCCCATTTCGCGTGCATTTCCCGAACCCT
 
. : . : . : . : . : . :
JMSF048O04- CAAAACCAGACATCGACGAACAACCAAAAAACCCACTTCTTCAAACCCTTCTTCCCTCCT
                      ____________________________________________________________
consensus CAAAACCAGACATCGACGAACAACCAAAAAACCCACTTCTTCAAACCCTTCTTCCCTCCT
 
. : . : . : . : . : . :
JMSF048O04- TCCCATTTATCAAGAAAAAAAAGTGATTAATCGAGAGTGAAGCACACAGAAACCTATTGA
                      ____________________________________________________________
consensus TCCCATTTATCAAGAAAAAAAAGTGATTAATCGAGAGTGAAGCACACAGAAACCTATTGA
 
. : . : . : . : . : . :
JMSF048O04- TTATTGCCATTGTTTCCGATAATTATATGTATATTTATTGTATTTACTTTGAATGCTCTA
                      ____________________________________________________________
consensus TTATTGCCATTGTTTCCGATAATTATATGTATATTTATTGTATTTACTTTGAATGCTCTA
 
. : . : . : . : . : . :
JMSF048O04- ACTGAGATCTTGTCCTTTCCTACAATGTTCTTCACTTTGTAGCGGACAAGGGTTCTTGAA
                      ____________________________________________________________
consensus ACTGAGATCTTGTCCTTTCCTACAATGTTCTTCACTTTGTAGCGGACAAGGGTTCTTGAA
 
. : . : . : . : . : . :
JMSF048O04- TCGGATCAGAATTTCCGACTGAGTTAGGGTTTTGATCAGCAATTCCGAACTTGGCCGTTG
                      ____________________________________________________________
consensus TCGGATCAGAATTTCCGACTGAGTTAGGGTTTTGATCAGCAATTCCGAACTTGGCCGTTG
 
. : . : . : . : . : . :
JMSF048O04- AATTCGGATTATTGGGTGGTGCTTAGTGGTTATTTACTGGTCACGGTTTCATTGATGGAT
                      ____________________________________________________________
consensus AATTCGGATTATTGGGTGGTGCTTAGTGGTTATTTACTGGTCACGGTTTCATTGATGGAT
 
. : . : . : . : . : . :
JMSF048O04- CGCCCCATTAATGGGAGTGTTCTGTGATCTTCCCGGGCTTCAAGCTGAAAATTGGTGGTG
                      ____________________________________________________________
consensus CGCCCCATTAATGGGAGTGTTCTGTGATCTTCCCGGGCTTCAAGCTGAAAATTGGTGGTG
 
. : . : . : . : . : . :
JMSF048O04- AATTTGGCTCTTCTGAATGCTAATAAATGAATAATACTGGTATTCTATTTTGCTTGTTCT
rJMSF048O04+ GTTCT
                      ____________________________________________________________
consensus AATTTGGCTCTTCTGAATGCTAATAAATGAATAATACTGGTATTCTATTTTGCTTGTTCT
 
. : . : . : . : . : . :
JMSF048O04- GAAAGGGCATGGAAGAGGACTGTAGATACAAGTAGAACTGTGTAGTGGGAGTGAAGAGAA
rJMSF048O04+ GAAAGGGCATNGAAGAGGACTGTAGATACAAGTAGAACTGTGTAGTGGGAGTGAAGAGAA
                      ____________________________________________________________
consensus GAAAGGGCATGGAAGAGGACTGTAGATACAAGTAGAACTGTGTAGTGGGAGTGAAGAGAA
 
. : . : . : . : . : . :
JMSF048O04- AGTAAAAAAACAAAAATTGAGAACACTTTGAAGTGTTAAAACATCAAAATCAGAT
rJMSF048O04+ AGTAAAAAAACAAAAATTGAGAACACTTTGAAGTGTTAAAACATCAAAATCAGATTGGGA
                      ____________________________________________________________
consensus AGTAAAAAAACAAAAATTGAGAACACTTTGAAGTGTTAAAACATCAAAATCAGATTGGGA
 
. : . : . : . : . : . :
rJMSF048O04+ TATTTTCTTCTTAAGAAACCTTTTAGATTGACTCAGATTTAGTGGGAGCTTTTGCTATAT
                      ____________________________________________________________
consensus TATTTTCTTCTTAAGAAACCTTTTAGATTGACTCAGATTTAGTGGGAGCTTTTGCTATAT
 
. : . : . : . : . : . :
rJMSF048O04+ AGCAGCGATTATAGTGCTTTATCTAGTGCTATTGGTGATTACCATTGGTTTTGTTTTTCC
                      ____________________________________________________________
consensus AGCAGCGATTATAGTGCTTTATCTAGTGCTATTGGTGATTACCATTGGTTTTGTTTTTCC
 
. : . : . : . : . : . :
rJMSF048O04+ ATTGAGTTTTGAATAATACTGTTGGAACTTCTGGTGCATCTGGAGTAGAAGGCTTTGGAT
                      ____________________________________________________________
consensus ATTGAGTTTTGAATAATACTGTTGGAACTTCTGGTGCATCTGGAGTAGAAGGCTTTGGAT
 
. : . : . : . : . : . :
rJMSF048O04+ GAGTGATTCAATGGGGAGCTGAAATGGAGGCCTACTAAGCTGGAAAGGAATGTGGGGTCA
                      ____________________________________________________________
consensus GAGTGATTCAATGGGGAGCTGAAATGGAGGCCTACTAAGCTGGAAAGGAATGTGGGGTCA
 
. : . : . : . : . : . :
rJMSF048O04+ TGGTGCATGGACAAGAATATAGTGGCTCGTTTGTTCCCTTACTGGAACATTGTTTTGAGA
                      ____________________________________________________________
consensus TGGTGCATGGACAAGAATATAGTGGCTCGTTTGTTCCCTTACTGGAACATTGTTTTGAGA
 
. : . : . : . : . : . :
rJMSF048O04+ AAGTGATTGGAGGATACTGGTTTTCCAACAGCACTCGTTTTGCCTGTTGTATAATTGTGT
                      ____________________________________________________________
consensus AAGTGATTGGAGGATACTGGTTTTCCAACAGCACTCGTTTTGCCTGTTGTATAATTGTGT
 
. : . : . : . : . : . :
rJMSF048O04+ GCAATGTCTCGCTGCTTTCCATTTCCACCACCGGGATATGAAAACAAGGCTAGATCAGAA
                      ____________________________________________________________
consensus GCAATGTCTCGCTGCTTTCCATTTCCACCACCGGGATATGAAAACAAGGCTAGATCAGAA
 
. : . : . : . : . : . :
rJMSF048O04+ GATGCAGACTTGCTAAAAGAGGAAAAGCGCAAAGAAAAAAAACATAAAAAGGAGAAGAAA
                      ____________________________________________________________
consensus GATGCAGACTTGCTAAAAGAGGAAAAGCGCAAAGAAAAAAAACATAAAAAGGAGAAGAAA
 
. : . : . : . : . : . :
rJMSF048O04+ GACAAAGAGAAGGGAGAAGGTAAAGAGAAAAGGGAGAAAGATAGAAGTGATGGGAAACAC
                      ____________________________________________________________
consensus GACAAAGAGAAGGGAGAAGGTAAAGAGAAAAGGGAGAAAGATAGAAGTGATGGGAAACAC