Previous Contig 013795:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031F16Sequence620014687629013795 (8)
JMFN019P06Sequence610013795 (8)gb:AY128293_15805940.006Arabidopsis thaliana At1g09730/F21M12_12 mRNA, complete cds.>gb:BT001039_1635294
JMSF002B17Sequence224005086 (7)751013795 (8)
JMSF009J11Sequence330005086 (7)693013795 (8)
JMSF017A16Sequence348005086 (7)764013795 (8)
JMSF037A08Sequence471005086 (7)665013795 (8)
JMSF039K19Sequence422005086 (7)315013795 (8)
JMSF048O01Sequence668020456pir|T04979|T049794e-05hypothetical protein T16L1.110 - Arabidopsis thaliana>gb:ATCHRIV79_1547282 Arabi751013795 (8)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN019P06- ACCAGTCAGGGCTTTGAGATGAATCGGCTCTCAGCCTCCTCTTTGAAG
                      ____________________________________________________________
consensus ACCAGTCAGGGCTTTGAGATGAATCGGCTCTCAGCCTCCTCTTTGAAG
 
. : . : . : . : . : . :
JMFN019P06- GATGGACAGTGTCCAATCAGTTCGGGATTGGTCTTGAGGGAGTCCTTTGAGCCTGAATCT
                      ____________________________________________________________
consensus GATGGACAGTGTCCAATCAGTTCGGGATTGGTCTTGAGGGAGTCCTTTGAGCCTGAATCT
 
. : . : . : . : . : . :
JMFN019P06- AATTTGCATGCGCAGATTGTTGTGCACTTTGATCGTTCAATTTCTTTCAGTGAGGTTAAG
                      ____________________________________________________________
consensus AATTTGCATGCGCAGATTGTTGTGCACTTTGATCGTTCAATTTCTTTCAGTGAGGTTAAG
 
. : . : . : . : . : . :
JMFN019P06- AATTCTTTGCCTTCAATTGAGGAGGAGGTGGAAACTGGTGGTAATTTTGTATATGCATCC
rJMSF017A16+ GGAGGTGGAAACTGGTGGTAATTTNGTATATGCATCC
rJMSF002B17+ GGTGGTAATTTTGTATATGCATCC
                      ____________________________________________________________
consensus AATTCTTTGCCTTCAATTGAGGAGGAGGTGGAAACTGGTGGTAATTTTGTATATGCATCC
 
. : . : . : . : . : . :
JMFN019P06- TCTCACACGACTGGATTTGGGGATCTTGGAGCTGTTGCGTCTGAAGCTTTTGTTTTCCCT
rJMSF017A16+ TCTCACACGACTGGATTTGGGGATCTTGGAGCTGTTGCGTCTGAAGCTTTTGTTTTCCCT
rJMSF009J11+ GAGCTGTTGCGTCTGAAGCTTTTGTTTTCCCT
rJMSF002B17+ TCTCACACGACTGGATTTGGGGATCTTGGAGCTGTTGCGTCTGAAGCTTTTGTTTTCCCT
                      ____________________________________________________________
consensus TCTCACACGACTGGATTTGGGGATCTTGGAGCTGTTGCGTCTGAAGCTTTTGTTTTCCCT
 
. : . : . : . : . : . :
JMFN019P06- TACTCTTCTAGGGATGTTGCATCTGAAGCGTCTTGGAAGCCACAAGTG-CCAGTTCACCA
rJMSF017A16+ TACTCTTCTAGGGATGTTGCATCTGAAGCGTCTTGGAAGCCACAAGTG-CCAGTTCACCA
rJMSF009J11+ TACTCTTCTAGGGATGTTGCATCTGAAGCGTCTTGGAAGCCACAAGTG-CCAGTTCACCA
rJMSF037A08+ TCTTCTAGGGATGTTGCATCTGAAGCGTCTTGGAAGCCACAAGTG-CCAGTTCACCA
rJMFF031F16+ CTGAAGCGTCTTGGAAGCCACAAGTGCCCAGTTCACCA
rJMSF002B17+ TACTCTTCTAGGGATGTTGCATCTGAAGCGTCTTGGAAGCCACAAGTG-CCAGTTCACCA
rJMSF048O01+ TGAAGCGTCTTGGAAGCCACAAGTG-CCAGTTCACCA
                      ____________________________________________________________
consensus TACTCTTCTAGGGATGTTGCATCTGAAGCGTCTTGGAAGCCACAAGTG-CCAGTTCACCA
 
. : . : . : . : . : . :
JMFN019P06- TGCTGCTGATGAGCACATTGGCTCCTCACCAGCCACAATTTGTCATGATCAGAATGACTT
rJMSF017A16+ TGCTGCTGATGAGCACATTGGCTCCTCACCAGCCACAATTTGTCATGATCAGAATGACTT
rJMSF009J11+ TGCTGCTGATGAGCACATTGGCTCCTCACCAGCCACAATTTGTCATGATCAGAATGACTT
rJMSF037A08+ TGCTGCTGATGAGCACATTGGCTCCTCACCAGCCACAATTTGTCATGATCAGAATGACTT
rJMFF031F16+ TGCTGCTGATGAGCACATTGGCTCCTCACCAGCCACAATTTGTCATGATCAGAATGACTT
rJMSF002B17+ TGCTGCTGATGAGCACATTGGCTCCTCACCAGCCACAATTTGTCATGATCAGAATGACTT
rJMSF048O01+ TGCTGCTGATGAGCACATTGGCTCCTCACCAGCCACAATTTGTCATGATCAGAATGACTT
                      ____________________________________________________________
consensus TGCTGCTGATGAGCACATTGGCTCCTCACCAGCCACAATTTGTCATGATCAGAATGACTT
 
. : . : . : . : . : . :
JMFN019P06- GGAAGTCGGGGTTGATGGAAAATGCATGGCAGTTGGAGAGGAGAGTTTAGATTGTGTGGA
rJMSF017A16+ GGAAGTCGGGGTTGATGGAAAATGCATGGCAGTTGGAGAGGAGAGTTTAGATTGTGTGGA
rJMSF009J11+ GGAAGTCGGGGTTGATGGAAAATGCATGGCAGTTGGAGAGGAGAGTTTAGATTGTGTGGA
rJMSF037A08+ GGAAGTCGGGGTTGATGGAAAATGCATGGCAGTTGGAGAGGAGAGTTTAGATTGTGTGGA
rJMFF031F16+ GGAAGTCGGGGTTGATGGAAAATGCATGGCAGTTGGAGAGGAGAGTTTAGATTGTGTGGA
rJMSF002B17+ GGAAGTCGGGGTTGATGGAAAATGCATGGCAGTTGGAGAGGAGAGTTTAGATTGTGTGGA
rJMSF048O01+ GGGAGTCGGGGTTGATGGAAAATGCATGGCAGTTGGAGAGGAGAGTTTAGATTGTGTGGA
                      ____________________________________________________________
consensus GGAAGTCGGGGTTGATGGAAAATGCATGGCAGTTGGAGAGGAGAGTTTAGATTGTGTGGA
 
. : . : . : . : . : . :
JMFN019P06- TCAGCTAGCTTCTACTGTAGAAGAAAACACAGAGTGCTTTACTGAATCTCTCCCTGCTGC
rJMSF017A16+ TCAGCTAGCTTCTACTGTAGAAGAAAACACAGAGTGCTTTACTGAATCTCTCCCTGCTGC
rJMSF009J11+ TCAGCTAGCTTCTACTGTAGAAGAAAACACAGAGTGCTTTACTGAATCTCTCCCTGCTGC
rJMSF037A08+ TCAGCTAGCTTCTACTGTAGAAGAAAACACAGAGTGCTTTACTGAATCTCTCCCTGCTGC
rJMFF031F16+ TCAGCTAGCTTCTACTGTAGAAGAAAACACAGAGTGCTTTACTGAATCTCTCCCTGCTGC
rJMSF002B17+ TCAGCTAGCTTCTACTGTAGAAGAAAACACAGAGTGCTTTACTGAATCTCTCCCTGCTGC
rJMSF048O01+ TCAGCTAGCTTCTACTGTAGAAGAAAACACAGAGTGCTTTACTGAATCTCTCCCTGCTGC
                      ____________________________________________________________
consensus TCAGCTAGCTTCTACTGTAGAAGAAAACACAGAGTGCTTTACTGAATCTCTCCCTGCTGC
 
. : . : . : . : . : . :
JMFN019P06- TACATCAAACATGATGTTTGACGTAGCAGCAGAGCCACAGAATGGTGTTGAACCCCATAG
rJMSF017A16+ TACATCAAACATGATGTTTGACGTAGCAGCAGAGCCACAGAATGGTGTTGAACCCCATAG
rJMSF009J11+ TACATCAAACATGATGTTTGACGTAGCAGCAGAGCCACAGAATGGTGTTGAACCCCATAG
rJMSF037A08+ TACATCAAACATGATGTTTGACGTAGCAGCAGAGCCACAGAATGGTGTTGAACCCCATAG
rJMFF031F16+ TACATCAAACATGATGTTTGACGTAGCAGCAGAGCCACAGAATGGTGTTGGACCCCATAG
rJMSF002B17+ TACATCAAACATGATGTTTGACGTAGCAGCAGAGCCACAGAATGGTGTTGAACCCCATAG
rJMSF048O01+ TACATCAAACATGATGTTTGACGTAGCAGCAGAGCCACAGAATGGTGTTGAACCCCATAG
                      ____________________________________________________________
consensus TACATCAAACATGATGTTTGACGTAGCAGCAGAGCCACAGAATGGTGTTGAACCCCATAG
 
. : . : . : . : . : . :
JMFN019P06- TCAAAGTGGCATTGTAGATTCAC
rJMSF017A16+ TCAAAGTGGCATTGTAGATTCACTCTCCGCTTCCCAGAACTTAACCGAGTTGTCTCAAAT
rJMSF009J11+ TCAAAGTGGCATTGTAGATTCACTCTCCGCTTCCCAGAACTTAACCGAGTTGTCTCAAAT
rJMSF037A08+ TCAAAGTGGCATTGTAGATTCACTCTCCGCTTCCCAGAACTTAACCGAGTTGTCTCAAAT
rJMFF031F16+ TCAAAGTGGCATTGTAGATTCACTCTCCGCTTCCCAGAACTTAGCCGAGTTGTCTCAAAT
rJMSF039K19+ CCAGAACTTAACCGAGTTGTCTCAAAT
rJMSF002B17+ TCAAAGTGGCATTGTAGATTCACTCTCCGCTTCCCAGAACTTAACCGAGTTGTCTCAAAT
rJMSF048O01+ TCAAAGTGGCATTGTAGATTCACTCTCCGCTTCCCAGAACTTAACCGAGTTGTCTCAAAT
                      ____________________________________________________________
consensus TCAAAGTGGCATTGTAGATTCACTCTCCGCTTCCCAGAACTTAACCGAGTTGTCTCAAAT
 
. : . : . : . : . : . :
rJMSF017A16+ TGAATTTCATGACAACACTAATATTGTTTCGAGAAATTTGGATGCCATTAATAGCGATGT
rJMSF009J11+ TGAATTTCATGACAACACTAATATTGTTTCGAGAAATTTGGATGCCATTAATAGCGATGT
rJMSF037A08+ TGAATTTCATGACAACACTAATATTGTTTCGAGAAATTTGGATGCCATTAATAGCGATGT
rJMFF031F16+ TGAATTTCATGACAACACTAATATTGTTTCGAGAAATTTGGATGCCATTAATAGCGATGT
rJMSF039K19+ TGAATTTCATGACAACACTAATATTGTTTCGAGAAATTTGGATCCCATTAATAGCGATGT
rJMSF002B17+ TGAATTTCATGACAACACTAATATTGTTTCGAGAAATTTGGATGCCATTAATAGCGATGT
rJMSF048O01+ TGAATTTCATGACAACACTAATATTGTTTCGAGAAATTTGGATGCCATTAATAGCGATGT
                      ____________________________________________________________
consensus TGAATTTCATGACAACACTAATATTGTTTCGAGAAATTTGGATGCCATTAATAGCGATGT
 
. : . : . : . : . : . :
rJMSF017A16+ GGTGGTGCAGCATGCTGCAAAAAAGATGCGACTGATGACTCCTGTTGAAAGGGAAGTTGA
rJMSF009J11+ GGTGGTGCAGCATGCTGCAAAAAAGATGCGACTGATGACTCCTGTTGAAAGGGAAGTTGA
rJMSF037A08+ GGTGGTGCAGCATGCTGCAAAAAAGATGCGACTGATGACTCCTGTTGAAAGGGAAGTTGA
rJMFF031F16+ GGTGGTGCAGCATGCTGCAAAAAAGATGCGACTGATGACTCCTGTTGAAAGGGAAGTTGA
rJMSF039K19+ GGTGGTGCAGCATGCTGCAAAAAAGATGCGACTGATGACTCCTGTTGAAAGGGAAGNTGA
rJMSF002B17+ GGTGGTGCAGCATGCTGCAAAAAAGATGCGACTGATGACTCCTGTTGAAAGGGAAGTTGA
rJMSF048O01+ GGTGGTGCAGCATGCTGCAAAAAAGATGCGACTGATGACTCCTGTTGAAAGGGAAGTTGA
                      ____________________________________________________________
consensus GGTGGTGCAGCATGCTGCAAAAAAGATGCGACTGATGACTCCTGTTGAAAGGGAAGTTGA
 
. : . : . : . : . : . :
rJMSF017A16+ GCTTAACCTCTCAAATGATCTGCATCTTTAACGGGTGACCATATTACAGGCATTTTGTTG
rJMSF009J11+ GCTTAACCTCTCAAATGATCTGCATCTTTAACGGGTGACCATATTACAGGCATTTTGTTG
rJMSF037A08+ GCTTAACCTCTCAAATGATCTGCATCTTTAACGGGTGACCATATTACAGGCATTTTGTTG
rJMFF031F16+ GCTTAACCTCTCAAATGATCTGCATCTTTAACGGGTGACCATATTACAGGCATTTTGTTG
rJMSF039K19+ GCTTAACCTCTCAAATGATCTGCATCTTTAACGGGNGNCCATATTACAGGCATTNTGTTG
rJMSF002B17+ GCTTAACCTCTCAAATGATCTGCATCTTTAACGGGTGACCATATTACAGGCATTTTGTTG
rJMSF048O01+ GCTTAACCTCTCAAATGATCTGCATCTTTAACGGGTGACCATATTACAGGCATTTTGTTG
                      ____________________________________________________________
consensus GCTTAACCTCTCAAATGATCTGCATCTTTAACGGGTGACCATATTACAGGCATTTTGTTG
 
. : . : . : . : . : . :
rJMSF017A16+ GTGCATTCTTGA-TCGATCCAATTTGTACATGCAAATTTAGA-CCTTGGGGTTGTA-GCT
rJMSF009J11+ GTGCATTCTTGA-TCGATCCAATTTGTACATGCAAATTTAGA-CCTTGGGGTTGTA-GCT
rJMSF037A08+ GTGCATTCTTGA-TCGATCCAATTTGTACATGCAAATTTAGATCCTTGGGGTTGTA-GCT
rJMFF031F16+ GTGCATTCTTGA-TCGATCCAATTTGTACATGCAAATTTAGA-CCTTGGGGTTGTA-GCT
rJMSF039K19+ GTGCATTCTNGACTCGATCCAATNNGTACATGCANATTTNGA-CCTNGGGGTNNTACGCN
rJMSF002B17+ GTGCATTCTTGA-TCGATCCAATTTGTACATGCAAATTTAGA-CCTTGGGGTTGTA-GCT
rJMSF048O01+ GTGCATTCTTGA-TCGATCCAATTTGTACATGCAAATTTAGA-CCTTGGGGTTGTA-GCT
                      ____________________________________________________________
consensus GTGCATTCTTGA-TCGATCCAATTTGTACATGCAAATTTAGA-CCTTGGGGTTGTA-GCT
 
. : . : . : . : . : . :
rJMSF017A16+ GGA-GTTGTAGGATA-TCGTGTTT-CTTGGTGTAGTTTATGA-CTCGCGGATA-CAATTA
rJMSF009J11+ GGA-GTTGTAGGATA-TCGTGTTT-CTTGGTGTAGTTTATGA-CTCGCGGATA-CAATTA
rJMSF037A08+ GGA-GTTGTAGGATATTCGTGTTT-CTTGGTGTAGTTTATGACCTCGCGGATACCAATTA
rJMFF031F16+ GGA-GTTGTAGGATA-TCGTGTTT-CTTGGTGTAGTTTATGA-CTCGCGGANA-CAA
rJMSF039K19+ GGATGTTGTNGGATA-TCGTGTTTGCTTGGTGTAGTTTATGA-CTCGCGGA
rJMSF002B17+ GGA-GTTGTAGGATA-TCGTGTTT-CTTGGTGTAGTTTATGA-CTCGCGGATA-CAATTA
rJMSF048O01+ GGA-GTTGTAGGATA-TCGTGTTT-CTTGGTGTAGTTTATGA-CTCGCGGATA-CAATTA
                      ____________________________________________________________
consensus GGA-GTTGTAGGATA-TCGTGTTT-CTTGGTGTAGTTTATGA-CTCGCGGATA-CAATTA
 
. : . : . : . : . : . :
rJMSF017A16+ TTACTTT
rJMSF009J11+ TTACTT
rJMSF037A08+ TTACTTT
rJMSF002B17+ TTACTTT
rJMSF048O01+ TTACTTTCCGTTTCCGTGTTATTATACATGTTAATGTCAATCTAACGCCAATACTTTCCT
                      ____________________________________________________________
consensus TTACTTTCCGTTTCCGTGTTATTATACATGTTAATGTCAATCTAACGCCAATACTTTCCT
 
. : . : . : . : . : . :
rJMSF048O01+ ACCAACATTGTTGTGCTTATATTTGTGTAAACAAATTTGAATGCGAAGTCATAAAGCCAC
                      ____________________________________________________________
consensus ACCAACATTGTTGTGCTTATATTTGTGTAAACAAATTTGAATGCGAAGTCATAAAGCCAC