Previous Contig 013792:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012H17Sequence548003887 (9)752013792 (4)
JMSF008C24Sequence392003887 (9)778013792 (4)gb:AY091772_15747320.048Arabidopsis thaliana AT4g24390/T22A6_220 mRNA, complete cds.>gb:BT006340_1639227
JMSF020B11Sequence691003887 (9)gb:AF139835_17714523e-17Populus tremula x Populus tremuloides F-box containing protein TIR1 (TIR1) mRNA,798013792 (4)
JMSF048M23Sequence696020452gb:AF139835_17714527e-95Populus tremula x Populus tremuloides F-box containing protein TIR1 (TIR1) mRNA,652013792 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF008C24+ GGAAGTGATCGATGGAATGCAAT
                      ____________________________________________________________
consensus GGAAGTGATCGATGGAATGCAAT
 
. : . : . : . : . : . :
rJMSF008C24+ GGGAAGGGATGCAAATGAATATGACATGGTAGCAAATGAATATGACACGGTATACATGTA
rJMSF020B11+ AGGGATGCAAATGAATATGACATGGTAGCAAATGNATATGACACGGTATACATGTA
                      ____________________________________________________________
consensus GGGAAGGGATGCAAATGAATATGACATGGTAGCAAATGAATATGACACGGTATACATGTA
 
. : . : . : . : . : . :
rJMSF008C24+ CCGGTCTCTTGATGAACCGAGATGCGACGCACCAAAGTTTGTGCAAATCTTTTGATGTTA
rJMSF020B11+ CCGGTCTCTTGATGAACCGAGATGCGACGCACCAAAGTTTGTGCAAATCTTTTGATGTTA
rJMFF012H17+ CTTGATGAACNGAGATGCGACGCACCAAAGTTTGTGCAAATCTTTTGATGTTA
                      ____________________________________________________________
consensus CCGGTCTCTTGATGAACCGAGATGCGACGCACCAAAGTTTGTGCAAATCTTTTGATGTTA
 
. : . : . : . : . : . :
rJMSF008C24+ GAAGAGATGAGCAAGGTTTTTTTTCAGTGATTTTAGCAGGCATCAGCAATGATTAGCTTT
rJMSF020B11+ GAAGAGATGAGCAAGGTTTTTTTTCAGTGATTTTAGCAGGCATCAGCAATGATTAGCTTT
rJMFF012H17+ GAAGAGATGAGCAAGGTTTTTTTTCAGTGATTTTAGCAGGCATCAGCAATGATTAGCTTT
                      ____________________________________________________________
consensus GAAGAGATGAGCAAGGTTTTTTTTCAGTGATTTTAGCAGGCATCAGCAATGATTAGCTTT
 
. : . : . : . : . : . :
rJMSF008C24+ ATTTTTTTTACTTATGTAAGATGTTACTATGCTGATGGCTGTTTGACCCACGAGTAAGGT
rJMSF020B11+ ATTTTTTTTACTTATGTAAGATGTTACTATGCTGATGGCTGTTTGACCCACGAGTAAGGT
rJMFF012H17+ ATTTTTTTTACTTATGTAAGATGTTACTATGCTGATGGCTGTTTGACCCACGAGTAAGGT
rJMSF048M23+ TACTTATGTAAGATGTTACTATGCTGATGGCTGTTTGACCCACGAGTAAGGT
                      ____________________________________________________________
consensus ATTTTTTTTACTTATGTAAGATGTTACTATGCTGATGGCTGTTTGACCCACGAGTAAGGT
 
. : . : . : . : . : . :
rJMSF008C24+ CCTGCTCCTGCATGCGTTGTTGTGCAAACGTGGTGCTTATTCAGATAGGGGAAATTGGAC
rJMSF020B11+ CCTGCTCCTGCATGCGTTGTTGTGCAAACGTGGTGCTTATTC--ATAGGGGAAATTGGAC
rJMFF012H17+ CCTGCTCCTGCATGCGTTGTTGTGCAAACGTGGTGCTTATTCAGATAGGGGAAATTGGAC
rJMSF048M23+ CCTGCTCCTGCATGCGTTGTTGTGCAAACGTGGTGCTTATTCAGATAGGGGAAATTGGAC
                      ____________________________________________________________
consensus CCTGCTCCTGCATGCGTTGTTGTGCAAACGTGGTGCTTATTCAGATAGGGGAAATTGGAC
 
. : . : . : . : . : . :
rJMSF008C24+ AATCAAGATGATATTCAGCTCCAGTCGTCTTCCAGTTGTGAAACATATATGAGGTTAATT
rJMSF020B11+ AATCAAGATGATATTCAGCTCCAGTCGTCTTCCAGTTGTGAAACATATATGAGGTTAATT
rJMFF012H17+ AATCAAGATGATATTCAGCTCCAGTCGTCTTCCAGTTGTGAAACATATATGAGGTTAATT
rJMSF048M23+ AATCAAGATGATATTCAGCTCCAGTCGTCTTCCAGTTGTGAAACATATATGAGGTTAATT
                      ____________________________________________________________
consensus AATCAAGATGATATTCAGCTCCAGTCGTCTTCCAGTTGTGAAACATATATGAGGTTAATT
 
. : . : . : . : . : . :
rJMSF008C24+ TAGTGATTTTTCCTGCAAGGTGCCGTGACAGCCGACAATACTGGTGTATTGGGTAATTTA
rJMSF020B11+ TAGTGATTTTTCCTGCAAGGTGCCGTGACAGCCGACAATACTGGTGTATTGGGTAATTTA
rJMFF012H17+ TAGTGATTTTTCCTGCAAGGTGCCGTGACAGCCGACAATACTGGTGTATTGGGTAATTTA
rJMSF048M23+ TAGTGATTTTTCCTGCAAGGTGCCGTGACAGCCGACAATACTGGTGTATTGGGTAATTTA
                      ____________________________________________________________
consensus TAGTGATTTTTCCTGCAAGGTGCCGTGACAGCCGACAATACTGGTGTATTGGGTAATTTA
 
. : . : . : . : . : . :
rJMSF008C24+ TTTTTGAACTTTTTCTTCCTTCATGATGTTCATTTCAGATAAAAGAAGCATTTTGACAAT
rJMSF020B11+ TTTTTGAACTTTTTCTTCCTTCATGATGTTCATTTCAGATAAAAGAAGCATTTTGACAAT
rJMFF012H17+ TTTTTGAACTTTTTCTTCCTTCATGATGTTCATTTCAGATAAAAGAAGCATTTTGACAAT
rJMSF048M23+ TTTTTGAACTTTTTCTTCCTTCATGATGTTCATTTCAGATAAAAGAAGCATTTTGACAAT
                      ____________________________________________________________
consensus TTTTTGAACTTTTTCTTCCTTCATGATGTTCATTTCAGATAAAAGAAGCATTTTGACAAT
 
. : . : . : . : . : . :
rJMSF008C24+ TGCAAGGGGAAGGGGATGATGGGGATGGGGGTGTAAAGCAGCATTGAGGGTCAGTGACCT
rJMSF020B11+ TGCAAGGGGAAGGGGATGATGGGGATGGGGGTGTAAAGCAGCATTGAGGGTCAGTGACCT
rJMFF012H17+ TGCAAGGGGAAGGGGATGATGGGGATGGGGGTGTAAAGCAGCATTGAGGGTCAGTGACCT
rJMSF048M23+ TGCAAGGGGAAGGGGATGATGGGGATGGGGGTGTAAAGCAGCATTGAGGGTCAGTGACCT
                      ____________________________________________________________
consensus TGCAAGGGGAAGGGGATGATGGGGATGGGGGTGTAAAGCAGCATTGAGGGTCAGTGACCT
 
. : . : . : . : . : . :
rJMSF008C24+ AAATAGAACAGACTTGTTGGTTGATTTGTCGCTCCTCCTTTGAGGTTTTGTAAGAAGGGT
rJMSF020B11+ AAATAGAACAGACTTGTTGGTTGATTTGTCGCTCCTCCTTTGAGGTTTTGTAAGAAGGGT
rJMFF012H17+ AAATAGAACAGACTTGTTGGTTGATTTGTCGCTCCTCCTTTGAGGTTTTGTAAGAAGGGT
rJMSF048M23+ AAATAGAACAGACTTGTTGGTTGATTTGTCGCTCCTCCTTTGAGGTTTTGTAAGAAGGGT
                      ____________________________________________________________
consensus AAATAGAACAGACTTGTTGGTTGATTTGTCGCTCCTCCTTTGAGGTTTTGTAAGAAGGGT
 
. : . : . : . : . : . :
rJMSF008C24+ GACCTAGAGAATTGGAGATTCAGAAGAGCATGAAGATCTGGATAGTAAACCATCATCCAG
rJMSF020B11+ GACCTAGAGAATTGGAGATTCAGAAGAGCATGAAGATCTGGATAGTAAACCATCATCCAG
rJMFF012H17+ GACCTAGAGAATTGGAGATTCAGAAGAGCATGAAGATCTGGATAGTAAACCATCATCCAG
rJMSF048M23+ GACCTAGAGAATTGGAGATTCAGAAGAGCATGAAGATCTGGATAGTAAACCATCATCCAG
                      ____________________________________________________________
consensus GACCTAGAGAATTGGAGATTCAGAAGAGCATGAAGATCTGGATAGTAAACCATCATCCAG
 
. : . : . : . : . : . :
rJMSF008C24+ TATAATTATTCCCTTTTGATAGAAAGAATTGAGCATCTACTTATTTTTCTTCCTGTTAGT
rJMSF020B11+ TATAATTATTCCCTTTTGATAGAAAGAATTGAGCATCTACTTATTTTTCTTCCTGTTAGT
rJMFF012H17+ TATAATTATTCCCTTTTGATAGAAAGAATTGAGCATCTACTTATTTTTCTTCCTGTTAGT
rJMSF048M23+ TATAATTATTCCCTTTTGATAGAAAGAATTGAGCATCTACTTATTTTTCTTCCTGTTAGT
                      ____________________________________________________________
consensus TATAATTATTCCCTTTTGATAGAAAGAATTGAGCATCTACTTATTTTTCTTCCTGTTAGT
 
. : . : . : . : . : . :
rJMSF008C24+ TTAGACTTTAGACCTGAAGCTGTAGCAGGTCCCCA
rJMSF020B11+ TTAGACTTTAGACTTGAAGCTGTAGCAGGTCCCCAGAACATATATCAGTCAGTGATCGAT
rJMFF012H17+ TTAGACTTTAGACTTGAAGCTGTAGCAGGTCCCCAGAACATATATCAGTCAGTGATCGAT
rJMSF048M23+ TTAGACTTTAGACTTGAAGCTGTAGCAGGTCCCCAGAACATATATCAGTCAGTGATCGAT
                      ____________________________________________________________
consensus TTAGACTTTAGACTTGAAGCTGTAGCAGGTCCCCAGAACATATATCAGTCAGTGATCGAT
 
. : . : . : . : . : . :
rJMSF020B11+ CTATTCTATGCACCTCTCTCTCTT
rJMFF012H17+ CTATTCTATGCACCTCTCTCTCTTTGTAGAACACTGTTT
rJMSF048M23+ CTATTCTATGCACCTCTCTCTCTTTGTAGAACACTGTTTATTTCCTTCCTTCAGATGTGT
                      ____________________________________________________________
consensus CTATTCTATGCACCTCTCTCTCTTTGTAGAACACTGTTTATTTCCTTCCTTCAGATGTGT