Previous Contig 013781:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005C10Sequence345009302 (6)gb:AB072919_15231231e-45Nicotiana tabacum NtGT2 mRNA for glucosyltransferase NTGT2, complete cds.491013781 (4)gb:AP000377_18198522e-20Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYM9.
JMSF022I08Sequence601004693 (4)gb:AF503770_18067718e-19Arabidopsis thaliana acyl-CoA synthetase-like protein mRNA, complete cds.772013781 (4)gb:AP000377_18198523e-61Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYM9.
JMSF031F22Sequence526004693 (4)gb:AF503770_18067713e-20Arabidopsis thaliana acyl-CoA synthetase-like protein mRNA, complete cds.695013781 (4)gb:AP000377_18198524e-46Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYM9.
JMSF048J02Sequence674004693 (4)gb:AF503770_18067716e-50Arabidopsis thaliana acyl-CoA synthetase-like protein mRNA, complete cds.714013781 (4)gb:AP000377_18198523e-49Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYM9.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF022I08+ ATGAGAATGG
                      ____________________________________________________________
consensus ATGAGAATGG
 
. : . : . : . : . : . :
rJMSF022I08+ ATGGCTAAATACCGGTGATATTGGTTGGATTGTTCCTCATCATTCTGTAGGGCGATCTCG
                      ____________________________________________________________
consensus ATGGCTAAATACCGGTGATATTGGTTGGATTGTTCCTCATCATTCTGTAGGGCGATCTCG
 
. : . : . : . : . : . :
rJMSF022I08+ CAATTCTTCTGGCGCTATTATTCTTGAAGGTCGTGCCAAGGATACTATAGTGCTTTCATC
                      ____________________________________________________________
consensus CAATTCTTCTGGCGCTATTATTCTTGAAGGTCGTGCCAAGGATACTATAGTGCTTTCATC
 
. : . : . : . : . : . :
rJMSF022I08+ AGGTGAAAATGTTGAACCATCTGAGATTGAAGAAGCTGCAATGGGTAGCAATTTGATTAA
rJMSF031F22+ AGGTGAAAATGTTGAACCATCTGAGATTGAAGAAGCTGCAATGGGTAGCAATTTGATTAA
rJMSF048J02+ AGGTGAAAATGTTGAACCATCTGAGATTGAAGAAGCTGCAATGGGTAGCAATTTGATTAA
                      ____________________________________________________________
consensus AGGTGAAAATGTTGAACCATCTGAGATTGAAGAAGCTGCAATGGGTAGCAATTTGATTAA
 
. : . : . : . : . : . :
rJMSF022I08+ ACAGATTGTTGTCTTTGGTCAGGATAAACGACGTCTTGGAGCTATTGTTGTACCACATAA
rJMSF031F22+ ACAGATTGTTGTCTTTGGTCAGGATAAACGACGTCTTGGAGCTATTGTTGTACCACATAA
rJMSF048J02+ ACAGATTGTTGTCTTTGGTCAGGATAAACGACGTCTTGGAGCTATTGTTGTACCACATAA
                      ____________________________________________________________
consensus ACAGATTGTTGTCTTTGGTCAGGATAAACGACGTCTTGGAGCTATTGTTGTACCACATAA
 
. : . : . : . : . : . :
rJMSF022I08+ AGAAGAGGTTCTTTTAGCTGCAAAAAAGTTGTCTGTGGTTGATTTTGATGCCACAGAAGT
rJMSF031F22+ AGAAGAGGTTCTTTTAGCTGCAAAAAAGTTGTCTGTGGTTGATTTTGATGCCACAGAAGT
rJMSF005C10+ GATGCCACAGAAGT
rJMSF048J02+ AGAAGAGGTTCTTTTAGCTGCAAAAAAGTTGTCTGTGGTTGATTTTGATGCCACAGAAGT
                      ____________________________________________________________
consensus AGAAGAGGTTCTTTTAGCTGCAAAAAAGTTGTCTGTGGTTGATTTTGATGCCACAGAAGT
 
. : . : . : . : . : . :
rJMSF022I08+ TAGCAAGGAGAAAACTGCTAACCTATTACATGAAGAACTTAGAAAATGGACAACAGGTTC
rJMSF031F22+ TAGCAAGGAGAAAACTGCTAACCTATTACATGAAGAACTTAGAAAATGGACAACAGGTTC
rJMSF005C10+ TAGCAAGGAGAAAACTGCTAACNTATTACATGAAGAACTTAGAAAATGGACAACAGGTTC
rJMSF048J02+ TAGCAAGGAGAAAACTGCTAACCTATTACATGAAGAACTTAGAAAATGGACAACAGGTTC
                      ____________________________________________________________
consensus TAGCAAGGAGAAAACTGCTAACCTATTACATGAAGAACTTAGAAAATGGACAACAGGTTC
 
. : . : . : . : . : . :
rJMSF022I08+ TGCGTTTCAAATTGGACCTCTCCTTGTCATTGACGAGCCTTTTACGATTGATAACGGTTT
rJMSF031F22+ TGCGTTTCAAATTGGACCTCTCCTTGTCATTGACGAGCCTTTTACGATTGATAACGGTTT
rJMSF005C10+ TGCGTTTCAAATTGGACCTCTCCTTGTCATTGACGAGCCTTTTACGATTGATAACGGTTT
rJMSF048J02+ TGCGTTTCAAATTGGACCTCTCCTTGTCATTGACGAGCCTTTTACGATTGATAACGGTTT
                      ____________________________________________________________
consensus TGCGTTTCAAATTGGACCTCTCCTTGTCATTGACGAGCCTTTTACGATTGATAACGGTTT
 
. : . : . : . : . : . :
rJMSF022I08+ GTTAACTCCAACAATGAAAGTTAGGAGAAACAAAGTAACAGATCTATACAAAGAGCAAAT
rJMSF031F22+ GTTAACTCCAACAATGAAAGTTAGGAGAAACAAAGTAACAGATCTATACAAAGAGCAAAT
rJMSF005C10+ GTTAACTCCAACAATGAAAGTTAGGAGAAACAAAGTAACAGATCTATACAAAGAGCAAAT
rJMSF048J02+ GTTAACTCCAACAATGAAAGTTAGGAGAAACAAAGTAACAGATCTATACAAAGAGCAAAT
                      ____________________________________________________________
consensus GTTAACTCCAACAATGAAAGTTAGGAGAAACAAAGTAACAGATCTATACAAAGAGCAAAT
 
. : . : . : . : . : . :
rJMSF022I08+ TGACAATCTGTACAAGTGACTTCCCCACAATGTTCGTTTGTAATTGAACCAATGGTATTA
rJMSF031F22+ TGACAATCTGTACAAGTGACTTCCCCACAATGTTCGTTTGTAATTGAACCAATGGTATTA
rJMSF005C10+ TGACAATCTGTACAAGTGACTTCCCCACAATGTTCGTTTGTAATTGAACCAATGGTATTA
rJMSF048J02+ TGACAATCTGTACAAGTGACTTCCCCACAATGTTCGTTTGTAATTGAACCAATGGTATTA
                      ____________________________________________________________
consensus TGACAATCTGTACAAGTGACTTCCCCACAATGTTCGTTTGTAATTGAACCAATGGTATTA
 
. : . : . : . : . : . :
rJMSF022I08+ ATAATAAGTCAGGTGCCTTGATGCTCAAGATACCTATAGGTTTTACATGATAAGTGAGTT
rJMSF031F22+ ATAATAAGTCAGGTGCCTTGATGCTCAAGATACCTATAGGTTTTACATGATAAGTGAGTT
rJMSF005C10+ ATAATAAGTCAGGTGCCTTGATGCTCAAGATACCTATAGGTTTTACATGATAAGTGAGTT
rJMSF048J02+ ATAATAAGTCAGGTGCCTTGATGCTCAAGATACCTATAGGTTTTACATGATAAGTGAGTT
                      ____________________________________________________________
consensus ATAATAAGTCAGGTGCCTTGATGCTCAAGATACCTATAGGTTTTACATGATAAGTGAGTT
 
. : . : . : . : . : . :
rJMSF022I08+ GTAAAATTATAATAGTAAATAATAATAGTAATAAGTTAGGGCAATTGTTATTTCATATTT
rJMSF031F22+ GTAAAATTATAATAGTAAATAATAATAGTAATAAGTTAGGGCAATTGTTATTTCATATTT
rJMSF005C10+ GTAAAATTATAATAGTAAATAATAATAGTAATAAGTTAGGGCAATTGTTATTTCATATTT
rJMSF048J02+ GTAAAATTATAATAGTAAATAATAATAGTAATAAGTTAGGGCAATTGTTATTTCATATTT
                      ____________________________________________________________
consensus GTAAAATTATAATAGTAAATAATAATAGTAATAAGTTAGGGCAATTGTTATTTCATATTT
 
. : . : . : . : . : . :
rJMSF022I08+ CTAGGGGGTACAAAGTGATTTGCTCACTAGGAGCATGCTCAATTAAATTGACCTTCATGT
rJMSF031F22+ CTAGGGGGTACAAAGTGATTTGCTCACTAGGAGCATGCTCAATTAAATTGACCTTCATGT
rJMSF005C10+ CTAGGGGGTACAAAGTGATTTGCTCACTAGGAGCATGCTCAATTAAATTGACCTTCATGT
rJMSF048J02+ CTAGGGGGTACAAAGTGATTTGCTCACTAGGAGCATGCTCAATTAAATTGACCTTCATGT
                      ____________________________________________________________
consensus CTAGGGGGTACAAAGTGATTTGCTCACTAGGAGCATGCTCAATTAAATTGACCTTCATGT
 
. : . : . : . : . : . :
rJMSF022I08+ TGAACATTTACTCATTTAGGTAATCTATAATGATGTAATAAT
rJMSF031F22+ TGAACATTTACTCATTTAGGTAATCTATAATGATGTAATAAT
rJMSF005C10+ TGAACATTTACTCATTTAGGTAATCTATAATGATGTAATAAT
rJMSF048J02+ TGAACATTTACTCATTTAGGTAATCTATAATGATGTAATAATTGAGTGGAATGAACATAT
                      ____________________________________________________________
consensus TGAACATTTACTCATTTAGGTAATCTATAATGATGTAATAATTGAGTGGAATGAACATAT