Previous Contig 013776:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF015E06Sequence513005534 (3)gb:AB052786_15212459e-61Glycine max mRNA for putative nitrate transporter NRT1-3, complete cds.725013776 (3)gb:AY064057_15659952e-72Arabidopsis thaliana putative peptide transporter protein (At5g46050) mRNA, comp
JMSF030H12Sequence654005534 (3)gb:AB052786_15212455e-81Glycine max mRNA for putative nitrate transporter NRT1-3, complete cds.721013776 (3)gb:AY064057_15659957e-76Arabidopsis thaliana putative peptide transporter protein (At5g46050) mRNA, comp
JMSF048H18Sequence705005534 (3)gb:AB052786_15212454e-94Glycine max mRNA for putative nitrate transporter NRT1-3, complete cds.772013776 (3)gb:AY064057_15659955e-81Arabidopsis thaliana putative peptide transporter protein (At5g46050) mRNA, comp

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF030H12+ GCAAGGCACCACTCTCAAC
rJMSF015E06+ GCAAGGCACCACTCTCAAC
rJMSF048H18+ AATGATTGCACAAATCAACACACTCTTTGTGAAGCAAGGCACCACTCTCAAC
                      ____________________________________________________________
consensus AATGATTGCACAAATCAACACACTCTTTGTGAAGCAAGGCACCACTCTCAAC
 
. : . : . : . : . : . :
rJMSF030H12+ AGAAGAGTAGGCAACTTCAACATCCCTCCAGCCAGTCTAGCCGGTTTCGTCACCATATCG
rJMSF015E06+ AGAAGAGTAGGCAACTTCAACATCCNTCCAGCCAGTCTAGCCGGNNTCGTCACCATATCG
rJMSF048H18+ AGAAGAGTAGGCAACTTCAACATCCCTCCAGCCAGTCTAGCCGGTTTCGTCACCATATCG
                      ____________________________________________________________
consensus AGAAGAGTAGGCAACTTCAACATCCCTCCAGCCAGTCTAGCCGGTTTCGTCACCATATCG
 
. : . : . : . : . : . :
rJMSF030H12+ CTGCTCGTCTCAGTTGCTATATACGACCGGTTCTTCGTCCCCCTCATCAAGAAATGGACT
rJMSF015E06+ CTGCTCGTCTCAGTTGCTATATACGACCGGNTNTTCGTCCCCCTCATCAAGAAATGGACT
rJMSF048H18+ CTGCTCGTCTCAGTTGCTATATACGACCGGTTCTTCGTCCCCCTCATCAAGAAATGGACT
                      ____________________________________________________________
consensus CTGCTCGTCTCAGTTGCTATATACGACCGGTTCTTCGTCCCCCTCATCAAGAAATGGACT
 
. : . : . : . : . : . :
rJMSF030H12+ AGAAACCCGAGAGGGATAAATCTTCTCCAACGTATGGGAATAGGTACAGCTCTCCACATT
rJMSF015E06+ AGAAACCCGAGAGGGATAAATCTTCTCCAACGTATGGGAATAGGTACAGCTCTCCACATT
rJMSF048H18+ AGAAACCCGAGAGGGATAAATCTTCTCCAACGTATGGGAATAGGTACAGCTCTCCACATT
                      ____________________________________________________________
consensus AGAAACCCGAGAGGGATAAATCTTCTCCAACGTATGGGAATAGGTACAGCTCTCCACATT
 
. : . : . : . : . : . :
rJMSF030H12+ GTCATCATGGTAGTGGCTTCGTTAACCGAGAAGTACAGGCTCAGTGTGGCTAGAGACCAT
rJMSF015E06+ GTCATCATGGTAGTGGCTTCGTTAACCGAGAAGTACAGGCTCAGTGTGGCTAGAGACCAN
rJMSF048H18+ GTCATCATGGTAGTGGCTTCGTTAACCGAGAAGTACAGGCTCAGTGTGGCTAGAGACCAT
                      ____________________________________________________________
consensus GTCATCATGGTAGTGGCTTCGTTAACCGAGAAGTACAGGCTCAGTGTGGCTAGAGACCAT
 
. : . : . : . : . : . :
rJMSF030H12+ GGCGTCGTCGAGAATGGAGGCCAAGTCCCCTTATCCATATTCATCTTGCTCCCTCAGTTC
rJMSF015E06+ GGCGTCGTCGAGAATGGAGGCCAAGTCCCCTTATCCATATTCATCTTGCTCCCTCAGTTC
rJMSF048H18+ GGCGTCGTCGAGAATGGAGGCCAAGTCCCCTTATCCATATTCATCTTGCTCCCTCAGTTC
                      ____________________________________________________________
consensus GGCGTCGTCGAGAATGGAGGCCAAGTCCCCTTATCCATATTCATCTTGCTCCCTCAGTTC
 
. : . : . : . : . : . :
rJMSF030H12+ ATCCTGATGGGAACTGCTGACGCATTCCTCGAAGTCGCCAAGATTGAGTTCTTCTATGAC
rJMSF015E06+ ATCCTGATGGGAACTGCTGACGCATTCCTCGAAGTCGCCAAGATTGAGTTCTTCTATGAC
rJMSF048H18+ ATCCTGATGGGAACTGCTGACGCATTCCTCGAAGTCGCCAAGATTGAGTTCTTCTATGAC
                      ____________________________________________________________
consensus ATCCTGATGGGAACTGCTGACGCATTCCTCGAAGTCGCCAAGATTGAGTTCTTCTATGAC
 
. : . : . : . : . : . :
rJMSF030H12+ CAAGCACCAGAGAGCATGAAGAGCTTGGGGACATCCTATTCCATGACAACCTTAGGAGTT
rJMSF015E06+ CAAGCACCAGAGAGCATGAAGAGCTTGGGGACATCNTATTCCATGACAACCTTAGGAGTT
rJMSF048H18+ CAAGCACCAGAGAGCATGAAGAGCTTGGGGACATCCTATTCCATGACAACCTTAGGAGTT
                      ____________________________________________________________
consensus CAAGCACCAGAGAGCATGAAGAGCTTGGGGACATCCTATTCCATGACAACCTTAGGAGTT
 
. : . : . : . : . : . :
rJMSF030H12+ GGGAACTTCCTCAGCAGTGTTTTGCTCTCCAATGTTTCGCGCATCACAAAAAGGAACGGG
rJMSF015E06+ GGGAACTTCCTCAGCAGTGTTTTGCTCTCCAATGTTTCGCGCATCACAAAAAGGAACGGG
rJMSF048H18+ GGGAACTTCCTCAGCAGTGTTTTGCTCTCCAATGTTTCGCGCATCACAAAAAGGAACGGG
                      ____________________________________________________________
consensus GGGAACTTCCTCAGCAGTGTTTTGCTCTCCAATGTTTCGCGCATCACAAAAAGGAACGGG
 
. : . : . : . : . : . :
rJMSF030H12+ CACCGAGGATGGATCCTCAACAACCTCAACGCCTCCCACCTCGACTACTACTACGCCTTC
rJMSF015E06+ CACCGAGGATGGATCCTCAACAACCTCAACGCCTCCCACCTCGACTACTACTACGCCTTC
rJMSF048H18+ CACCGAGGATGGATCCTCAACAACCTCAACGCCTCCCACCTCGACTACTACTACGCCTTC
                      ____________________________________________________________
consensus CACCGAGGATGGATCCTCAACAACCTCAACGCCTCCCACCTCGACTACTACTACGCCTTC
 
. : . : . : . : . : . :
rJMSF030H12+ TTCGCGATACTTAATGCCCTCAACTTCATTTTCTTCCTAGTTGTGTCTAGGTTTTATGTG
rJMSF015E06+ TTCGCGATACTTAATGCCCTCAACTTCATTTTCTTCCTAGTTGTGTCTAGGTTTTATGTG
rJMSF048H18+ TTCGCGATACTTAATGCCCTCAACTTCATTTTCTTCCTAGTTGTGTCTAGGTTTTATGTG
                      ____________________________________________________________
consensus TTCGCGATACTTAATGCCCTCAACTTCATTTTCTTCCTAGTTGTGTCTAGGTTTTATGTG
 
. : . : . : . : . : . :
rJMSF030H12+ TACAAGGCTGAGGTTTCTGACTCCATGGTTGTCTTGAGACAAGAGTTGGAGGTTGGGACA
rJMSF015E06+ TACAAGGCTGAGGTTTCTGACTCCATGGTTGTCTTGAGACAAGAGTTGGAGGTTGGGACA
rJMSF048H18+ TACAAGGCTGAGGTTTCTGACTCCATGGTTGTCTTGAGACAAGAGTTGGAGGTTGGGACA
                      ____________________________________________________________
consensus TACAAGGCTGAGGTTTCTGACTCCATGGTTGTCTTGAGACAAGAGTTGGAGGTTGGGACA
 
. : . : . : . : . : . :
rJMSF030H12+ AAACACAAAGTTAATAGCCAAGAAACATCCAGGAAATAGA
rJMSF015E06+ AAACACAAAGTTAATAGCCAAGAAACATCCAGGAAATAGA
rJMSF048H18+ AAACACAAAGTTAATAGCCAAGAAACATCCAGGAAATAGACTAATTAACTAAGAACATTA
                      ____________________________________________________________
consensus AAACACAAAGTTAATAGCCAAGAAACATCCAGGAAATAGACTAATTAACTAAGAACATTA