Previous Contig 013766:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF048F18Sequence688013766 (2)pir|G71406|G714065e-55probable retrovirus-related polyprotein - Arabidopsis thaliana>gb:ATCHRIV39_1545776013766 (2)pir|G71406|G714067e-60probable retrovirus-related polyprotein - Arabidopsis thaliana>gb:ATCHRIV39_1545

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF048F18- GACCTTCTGTTTGAGACTTGTGCCTTCTGCTGTATGTGGTACCACCCCCGCAAGCT
rJMSF048F18+ GACCTTCTGTTTGAGACNTGTGCCTTCTGCTGTATGTGGTACCACCCCCGCAAGCT
                      ____________________________________________________________
consensus GACCTTCTGTTTGAGACTTGTGCCTTCTGCTGTATGTGGTACCACCCCCGCAAGCT
 
. : . : . : . : . : . :
JMSF048F18- GGAAGGTACATGTTGTGTAATTCCAGCTTGGAAATGAGATCATAGAAGCTATTCTGTGCA
rJMSF048F18+ GGAAGGTACATGTTGTGTAATTCCAGCTTGGAAATGAGATCATAGAAGCTATTCTGTGCA
                      ____________________________________________________________
consensus GGAAGGTACATGTTGTGTAATTCCAGCTTGGAAATGAGATCATAGAAGCTATTCTGTGCA
 
. : . : . : . : . : . :
JMSF048F18- TGAGGTTCGGTAAAAACATATGCAAGCTAGTTAGATGTGGAGACATGTAGTAACTTTAGG
rJMSF048F18+ TGAGGTTCGGTAAAAACATATGCAAGCTAGTTAGATGTGGAGACATGTAGTAACTTTAGG
                      ____________________________________________________________
consensus TGAGGTTCGGTAAAAACATATGCAAGCTAGTTAGATGTGGAGACATGTAGTAACTTTAGG
 
. : . : . : . : . : . :
JMSF048F18- ACTCCTTTTTGTAGTTTCTCTCTTACTAGGTGATAGTCTATTTCAACATGTTTTGTTCTC
rJMSF048F18+ ACTCCTTTTTGTAGTTTCTCTCTTACTAGGTGATAGTCTATTTCAACATGTTTTGTTCTC
                      ____________________________________________________________
consensus ACTCCTTTTTGTAGTTTCTCTCTTACTAGGTGATAGTCTATTTCAACATGTTTTGTTCTC
 
. : . : . : . : . : . :
JMSF048F18- TAATGAAACACAGGGTTTTCAGCTATAGCAATGGCAGACTTGTTGTCACAATACAACAAG
rJMSF048F18+ TAATGAAACACAGGGTTTTCAGCTATAGCAATGGCAGACTTGTTGTCACAATACAACAAG
                      ____________________________________________________________
consensus TAATGAAACACAGGGTTTTCAGCTATAGCAATGGCAGACTTGTTGTCACAATACAACAAG
 
. : . : . : . : . : . :
JMSF048F18- GCTGGAGGATTTTTAGCTATCCCCACATCCTGCACAAGATATAGTAGCCATTAGATCTCA
rJMSF048F18+ GCTGGAGGATTTTTAGCTATCCCCACATCCTGCACAAGATATAGTAGCCATTAGATCTCA
                      ____________________________________________________________
consensus GCTGGAGGATTTTTAGCTATCCCCACATCCTGCACAAGATATAGTAGCCATTAGATCTCA
 
. : . : . : . : . : . :
JMSF048F18- CAAGCTCGTATTGGCTAAGGCCCTATATTCTAAGAAGAGCTTCTAGATATGGTGGCCTGC
rJMSF048F18+ CAAGCTCGTATTGGCTAAGGCCCTATATTCTAAGAAGAGCTTCTAGATATGGTGGCCTGC
                      ____________________________________________________________
consensus CAAGCTCGTATTGGCTAAGGCCCTATATTCTAAGAAGAGCTTCTAGATATGGTGGCCTGC
 
. : . : . : . : . : . :
JMSF048F18- TTCTTGGACTTCCAAGTGATCATAGATGTGCTAAGGAATATGCAGAAACCAGTAACAGAT
rJMSF048F18+ TTCTTGGACTTCCAAGTGATCATAGATGTGCTAAGGAATATGCAGAAACCAGTAACAGAT
                      ____________________________________________________________
consensus TTCTTGGACTTCCAAGTGATCATAGATGTGCTAAGGAATATGCAGAAACCAGTAACAGAT
 
. : . : . : . : . : . :
JMSF048F18- CTCCTGGTGTCTGGACAAGCAGCCCAATCTGAGTCAGTGAACCCCTTCAGCTTCAAGGAT
rJMSF048F18+ CTCCTGGTGTCTGGACAAGCAGCCCAATCTGAGTCAGTGAACCCCTTCAGCTTCAAGGAT
                      ____________________________________________________________
consensus CTCCTGGTGTCTGGACAAGCAGCCCAATCTGAGTCAGTGAACCCCTTCAGCTTCAAGGAT
 
. : . : . : . : . : . :
JMSF048F18- GAAGTGGCTGGGAAAAAGAGACCTTGCCCTGGAGCTTCTTTGATGTACCTTAGAATCTTG
rJMSF048F18+ GAAGTGGCTGGGAAAAAGAGACCTTGCCCTGGAGCTTCTTTGATGTACCTTAGAATCTTG
                      ____________________________________________________________
consensus GAAGTGGCTGGGAAAAAGAGACCTTGCCCTGGAGCTTCTTTGATGTACCTTAGAATCTTG
 
. : . : . : . : . : . :
JMSF048F18- TGAGCTGCGGCCTGCATATGTATGTTGGTAGGGCATTCTAAGAACTGAAATAACTGTTGA
rJMSF048F18+ TGAGCTGCGGCCTGCATATGTATGTTGGTAGGGCATTCTAAGAACTGAAATAACTGTTGA
                      ____________________________________________________________
consensus TGAGCTGCGGCCTGCATATGTATGTTGGTAGGGCATTCTAAGAACTGAAATAACTGTTGA
 
. : . : . : . : . : . :
JMSF048F18- GTGGCATATCTAATGTCAAGTCTTGTAATAGT
rJMSF048F18+ GTGGCATATCTAATGTCAAGTCTTGTAATAGTTAGATACAAGAGTTTTCCCACAAGCCTT
                      ____________________________________________________________
consensus GTGGCATATCTAATGTCAAGTCTTGTAATAGTTAGATACAAGAGTTTTCCCACAAGCCTT
 
. : . : . : . : . : . :
rJMSF048F18+ CTGTGCTTATGTCCAGTGTCTTTGCTTAACCCTGATTGATGTAACCATGGGGCTTAACTG
                      ____________________________________________________________
consensus CTGTGCTTATGTCCAGTGTCTTTGCTTAACCCTGATTGATGTAACCATGGGGCTTAACTG