Previous Contig 013763:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011M10Sequence579001464 (5)gb:AC137997_17439073e-08Oryza sativa chromosome 3 BAC OJ1499_D04 genomic sequence, complete sequence.>gb763013763 (5)gb:AC137997_17439071e-56Oryza sativa chromosome 3 BAC OJ1499_D04 genomic sequence, complete sequence.>gb
JMFF032H13Sequence478001464 (5)gb:AC137997_17439072e-05Oryza sativa chromosome 3 BAC OJ1499_D04 genomic sequence, complete sequence.>gb588013763 (5)gb:AC137997_17439077e-27Oryza sativa chromosome 3 BAC OJ1499_D04 genomic sequence, complete sequence.>gb
JMFF051J12Sequence429001464 (5)gb:AP003904_18350034e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ10233013763 (5)
JMSF002H10Sequence486001464 (5)gb:AC137997_17439072e-06Oryza sativa chromosome 3 BAC OJ1499_D04 genomic sequence, complete sequence.>gb749013763 (5)gb:AC137997_17439078e-57Oryza sativa chromosome 3 BAC OJ1499_D04 genomic sequence, complete sequence.>gb
JMSF048E04Sequence698001464 (5)gb:AC137997_17439072e-18Oryza sativa chromosome 3 BAC OJ1499_D04 genomic sequence, complete sequence.>gb761013763 (5)gb:AC137997_17439076e-44Oryza sativa chromosome 3 BAC OJ1499_D04 genomic sequence, complete sequence.>gb

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF002H10+ CGACCCCGAGGCGATT
rJMFF011M10+ GCGATT
                      ____________________________________________________________
consensus CGACCCCGAGGCGATT
 
. : . : . : . : . : . :
rJMSF002H10+ CAGAGGTTGAATTTGCACACTGCTATGACGAATGGGAGGCATCTGCTGTGGTTGGTTGAG
rJMFF011M10+ CAGAGGTTGAATTTGCACACTGCTATGACGAATGGGAGGCATCTGCTGTGGTTGGTTGAG
                      ____________________________________________________________
consensus CAGAGGTTGAATTTGCACACTGCTATGACGAATGGGAGGCATCTGCTGTGGTTGGTTGAG
 
. : . : . : . : . : . :
rJMSF002H10+ AGGATGATTGAATTGAGGGTGGCTGATACAGCTGTGAAGGAGTGGAGCAATCAGGTTTCA
rJMFF011M10+ AGGATGATTGAATTGAGGGTGGCTGATACAGCTGTGAAGGAGTGGAGCAATCAGGTTTCA
rJMSF048E04+ GTGGCTGATACAGCTGTGAAGGAGTGGAGCAATCAGGTTTCA
                      ____________________________________________________________
consensus AGGATGATTGAATTGAGGGTGGCTGATACAGCTGTGAAGGAGTGGAGCAATCAGGTTTCA
 
. : . : . : . : . : . :
rJMSF002H10+ TTTACTGCTGATTTACAGAGAGCATTCCGAGATGATGCCTGGAGGAATTATGTTCCTGGG
rJMFF011M10+ TTTACTGCTGATTTACAGAGAGCATTCCGAGATGATGCCTGGAGGAATTATGTTCCTGGG
rJMSF048E04+ TTTACTGCTGATTTACAGAGAGCATTCCGAGATGATGCCTGGAGGAATTATGTTCCTGGG
                      ____________________________________________________________
consensus TTTACTGCTGATTTACAGAGAGCATTCCGAGATGATGCCTGGAGGAATTATGTTCCTGGG
 
. : . : . : . : . : . :
rJMSF002H10+ CTTCCTGCCGTTGTGCTTCGATGCACTTGCAAGCTTGCCAATGCTGTCTCAATGGGGACT
rJMFF011M10+ CTTCCTGCCGTTGTGCTTCGATGCACTTGCAAGCTTGCCAATGCTGTCTCAATGGGGACT
rJMSF048E04+ CTTCCTGCCGTTGTGCTTCGATGCACTTGCAAGCTTGCCAATGCTGTCTCAATGGGGACT
                      ____________________________________________________________
consensus CTTCCTGCCGTTGTGCTTCGATGCACTTGCAAGCTTGCCAATGCTGTCTCAATGGGGACT
 
. : . : . : . : . : . :
rJMSF002H10+ ATCCTGGCTGATAGACAGGTTAGAATGAAGCTCGTGAAAAATTGGCTTCCTGTGCTTATT
rJMFF032H13+ ACAGGTTAGAATGAAGCTCGTGAAAAATTGGCTTCCTGTGCTTATT
rJMFF011M10+ ATCCTGGCTGATAGACAGGTTAGAATGAAGCTCGTGAAAAATTGGCTTCCTGTGCTTATT
rJMSF048E04+ ATCCTGGCTGATAGACAGGTTAGAATGAAGCTCGTGAAAAATTGGCTTCCTGTGCTTATT
                      ____________________________________________________________
consensus ATCCTGGCTGATAGACAGGTTAGAATGAAGCTCGTGAAAAATTGGCTTCCTGTGCTTATT
 
. : . : . : . : . : . :
rJMSF002H10+ GCATGCAAAGACAATGTTTCGCCTATGATGCCTAATCACAAACAACTATATCTGGAGCTG
rJMFF032H13+ GCATGCAAAGACAATGTTTCGCCTATGATGCCTAATCACAAACAACTATATCTGGAGCTG
rJMFF011M10+ GCATGCAAAGACAATGTTTCGCCTATGATGCCTAATCACAAACAACTATATCTGGAGCTG
rJMSF048E04+ GCATGCAAAGACAATGTTTCGCCTATGATGCCTAATCACAAACAACTATATCTGGAGCTG
                      ____________________________________________________________
consensus GCATGCAAAGACAATGTTTCGCCTATGATGCCTAATCACAAACAACTATATCTGGAGCTG
 
. : . : . : . : . : . :
rJMSF002H10+ GAAGAAACATTCTTGAGGATTATATCAACACTTCCGCTCTCTGATGCTCAGGAGTTGTTG
rJMFF032H13+ GAAGAAACATTCTTGAGGATTATATCAACACTTCCGCTCTCTGATGCTCAGGAGTTGTTG
rJMFF011M10+ GAAGAAACATTCTTGAGGATTATATCAACACTTCCGCTCTCTGATGCTCAGGAGTTGTTG
rJMSF048E04+ GAAGAAACATTCTTGAGGATTATATCAACACTTCCGCTCTCTGATGCTCAGGAGTTGTTG
                      ____________________________________________________________
consensus GAAGAAACATTCTTGAGGATTATATCAACACTTCCGCTCTCTGATGCTCAGGAGTTGTTG
 
. : . : . : . : . : . :
rJMSF002H10+ CAACAGTGTCTTAGCTTCTCAACTCGGAATGTTGAAGACTGTCCTCACTTGATCAGTGCA
rJMFF032H13+ CAACAGTGTCTTAGCTTCTCAACTCGGAATGTTGAAGACTGTCCTCACTTGATCAGTGCA
rJMFF011M10+ CAACAGTGTCTTAGCTTCTCAACTCGGAATGTTGAAGACTGTCCTCACTTGATCAGTGCA
rJMSF048E04+ CAACAGTGTCTTAGCTTCTCAACTCGGAATGTTGAAGACTGTCCTCACTTGATCAGTGCA
                      ____________________________________________________________
consensus CAACAGTGTCTTAGCTTCTCAACTCGGAATGTTGAAGACTGTCCTCACTTGATCAGTGCA
 
. : . : . : . : . : . :
rJMSF002H10+ TTCACCACCTGGTTCCGCAGAGCAAACAGATCCCATGAGCAGAAAGACTTTGTCTGTAAA
rJMFF032H13+ TTCACCACCTGGTTCCGCAGAGCAAACAGATCCCATGAGCAGAAAGACTTTGTCTGTAAA
rJMFF011M10+ TTCACCACCTGGTTCCGCAGAGCAAACAGATCCCATGAGCAGAAAGACTTTGTCTGTAAA
rJMFF051J12+ GTAAA
rJMSF048E04+ TTCACCACCTGGTTCCGCAGAGCAAACAGATCCCATGAGCAGAAAGACTTTGTCTGTAAA
                      ____________________________________________________________
consensus TTCACCACCTGGTTCCGCAGAGCAAACAGATCCCATGAGCAGAAAGACTTTGTCTGTAAA
 
. : . : . : . : . : . :
rJMSF002H10+ AAATTTGGAGACTGGGCAGACTAGCTAACATGGACATAATATCACGTAGTTAACTCTTTT
rJMFF032H13+ AAATTTGGAGACTGGGCAGACTAGCTAACATGGACATAATATCACGTAGTTAACTCTTTT
rJMFF011M10+ AAATTTGGAGACTGGGCAGACTAGCTAACATGGACATAATATCACGTAGTTAACTCTTTT
rJMFF051J12+ AAATTTGGAGACTGGGCAGACTAGCTAACATGGACATAATATCACGTAGTTAACTCTTTT
rJMSF048E04+ AAATTTGGAGACTGGGCAGACTAGCTAACATGGACATAATATCACGTAGTTAACTCTTTT
                      ____________________________________________________________
consensus AAATTTGGAGACTGGGCAGACTAGCTAACATGGACATAATATCACGTAGTTAACTCTTTT
 
. : . : . : . : . : . :
rJMSF002H10+ CCCTACCAAATCTGTACATAGGCTTTTTAGTTTTCCTTTGGTGTTATACAGGAAGCATGG
rJMFF032H13+ CCCTACCAAATCTGTACATAGGCTTTTTAGTTTTCCTTTGGTGTTATACAGGAAGCATGG
rJMFF011M10+ CCCTACCAAATCTGTACATAGGCTTTTTAGTTTTCCTTTGGTGTTATACAGGAAGCATGG
rJMFF051J12+ CCCTACCAAATCTGTACATAGGCTTTTTAGTTTTCCTTTGGTGTTATACAGGAAGCATGG
rJMSF048E04+ CCCTACCAAATCTGTACATAGGCTTTTTAGTTTTCCTTTGGTGTTATACAGGAAGCATGG
                      ____________________________________________________________
consensus CCCTACCAAATCTGTACATAGGCTTTTTAGTTTTCCTTTGGTGTTATACAGGAAGCATGG
 
. : . : . : . : . : . :
rJMSF002H10+ TACACAGTGTTCTGTTAGTGTTACCCTGGTGCTATGAAAGTTTCCTTGAAC
rJMFF032H13+ TACACAGTGTTCTGTTAGTGTTA-CCTGGTGCTATGAAAGTTTCCTTGAACACCACTTGT
rJMFF011M10+ TACACAGTGTTCTGTTAGTGTTA-CCTGGTGCTATGAAAGTTTCCTTGAACACCACTTGT
rJMFF051J12+ TACACAGTGTTCTGTTAGTGTTA-CCTGGTGCTATGAAAGTTTCCTTGAACACCACTTGT
rJMSF048E04+ TACACAGTGTTCTGTTAGTGTTA-CCTGGTGCTATGAAAGTTTCCTTGAACACCACTTGT
                      ____________________________________________________________
consensus TACACAGTGTTCTGTTAGTGTTA-CCTGGTGCTATGAAAGTTTCCTTGAACACCACTTGT
 
. : . : . : . : . : . :
rJMFF032H13+ GACTCTACTTTGTTTTCAGAGTGGACAATGNTATATAA
rJMFF011M10+ GACTCTACTTTGTTTTCAGAGTGGACAATGTTATATAA
rJMFF051J12+ GACTTTACTTTGTTTTCAGAGTGGACAATGTTATATAATGATGTGATGT
rJMSF048E04+ GACTCTACTTTGTTTTCAGAGTGGACAATGTTATATAATGATGTGATGTAGATAAACTGG
                      ____________________________________________________________
consensus GACTCTACTTTGTTTTCAGAGTGGACAATGTTATATAATGATGTGATGTAGATAAACTGG
 
. : . : . : . : . : . :
rJMSF048E04+ CTCAATCTTCCTTCCCTGTTCCCCAATCTGTTCTTGCTGCTGCCATTATTTAAGCTCATG
                      ____________________________________________________________
consensus CTCAATCTTCCTTCCCTGTTCCCCAATCTGTTCTTGCTGCTGCCATTATTTAAGCTCATG