Previous Contig 013758:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF019B20Sequence236013758 (4)703013758 (4)gb:AK118894_18168472e-58Arabidopsis thaliana At3g26085 mRNA for unknown protein, complete cds, clone: RA
JMSF048C20Sequence730013758 (4)gb:AY074337_15674944e-23Arabidopsis thaliana unknown protein (At3g26085) mRNA, complete cds.>gb:AY091356755013758 (4)gb:AK118894_18168471e-44Arabidopsis thaliana At3g26085 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF048C20- GCGCAGCCTAACTTTTGTGCGGTGGTGGTTAAGAACC
                      ____________________________________________________________
consensus GCGCAGCCTAACTTTTGTGCGGTGGTGGTTAAGAACC
 
. : . : . : . : . : . :
JMSF019B20- AACTGAGAT
JMSF048C20- AACATAACTTCTGCTGTTAAATGAATTTGAAGGCCATATCCAACGACTCTTAACTGAGAT
                      ____________________________________________________________
consensus AACATAACTTCTGCTGTTAAATGAATTTGAAGGCCATATCCAACGACTCTTAACTGAGAT
 
. : . : . : . : . : . :
JMSF019B20- GGATACCTTCAAATAGTTCCCCAATTAAGCTATTTGGTTGCGTTATCGTTGATTTCATTG
JMSF048C20- GGATACCTTCAAATAGTTCCCCAATTAAGCTATTTGGTTGCGTTATCGTTGATTTCATTG
                      ____________________________________________________________
consensus GGATACCTTCAAATAGTTCCCCAATTAAGCTATTTGGTTGCGTTATCGTTGATTTCATTG
 
. : . : . : . : . : . :
JMSF019B20- ATGGATTTGGTTACTATGAATTCTTGCTGGAAGTTGAAGTCTTCTGCTTTTACATTCCTC
JMSF048C20- ATGGATTTGGTTACTATGAATTCTTGCTGGAAGTTGAAGTCTTCTGCTTTTACATTCCTC
                      ____________________________________________________________
consensus ATGGATTTGGTTACTATGAATTCTTGCTGGAAGTTGAAGTCTTCTGCTTTTACATTCCTC
 
. : . : . : . : . : . :
JMSF019B20- ACTGATTCTAGCGCTTCATGTTTCAAATTTTGTGCCTCTTGTTATTCACCAGGGCTCATC
JMSF048C20- ACTGATTCTAGCGCTTCATGTTTCAAATTTTGTGCCTCTTGTTATTCACCAGGGCTCATC
                      ____________________________________________________________
consensus ACTGATTCTAGCGCTTCATGTTTCAAATTTTGTGCCTCTTGTTATTCACCAGGGCTCATC
 
. : . : . : . : . : . :
JMSF019B20- CCCAGTTTATTGCACAGTAGATATAGTAGAGCTGATATTAGAGCTT
JMSF048C20- CCCAGTTTATTGCACAGTAGATATAGTAGAGCTGATATTAGAGCTTTCGCAAGTCCAGTC
                      ____________________________________________________________
consensus CCCAGTTTATTGCACAGTAGATATAGTAGAGCTGATATTAGAGCTTTCGCAAGTCCAGTC
 
. : . : . : . : . : . :
JMSF048C20- AAGAAATCAAGAATAAAACGCAGAAAAATAAAAGAGAACACTACATTACCCGAGAAACTT
                      ____________________________________________________________
consensus AAGAAATCAAGAATAAAACGCAGAAAAATAAAAGAGAACACTACATTACCCGAGAAACTT
 
. : . : . : . : . : . :
JMSF048C20- GTGGTGGATGATTGTAACATAGAGGATGAGTTGCAAGACAAAAATGGCACACCCACTTCA
                      ____________________________________________________________
consensus GTGGTGGATGATTGTAACATAGAGGATGAGTTGCAAGACAAAAATGGCACACCCACTTCA
 
. : . : . : . : . : . :
JMSF048C20- GATGTAGGGGAGGTTGAGAATTCTCAAACACTCCCATCTAGGACCTCTGTGCTTCAAGCA
                      ____________________________________________________________
consensus GATGTAGGGGAGGTTGAGAATTCTCAAACACTCCCATCTAGGACCTCTGTGCTTCAAGCA
 
. : . : . : . : . : . :
JMSF048C20- TGCACTATTACCTCTGGTTTAATATGCCTTTTGGGTTTTCTCATTCGTCAGGCCTCTCAT
                      ____________________________________________________________
consensus TGCACTATTACCTCTGGTTTAATATGCCTTTTGGGTTTTCTCATTCGTCAGGCCTCTCAT
 
. : . : . : . : . : . :
JMSF048C20- TTTGCATCAACAGAAGGATTGCCAGTTGCAGACTGCTCTGTTGAAATTTCTTGGGATTTT
rJMSF019B20+ CTTGGGATTTT
                      ____________________________________________________________
consensus TTTGCATCAACAGAAGGATTGCCAGTTGCAGACTGCTCTGTTGAAATTTCTTGGGATTTT
 
. : . : . : . : . : . :
JMSF048C20- CAGATGTGGCATCTTGAGTTGATTACTGGGCTGGTTATAATAGTATCCTCATGCCGATAT
rJMSF019B20+ CAGATGTGGCATCTTGAGTTGATTACTGGGCTGGTTATAATAGTATCCTCATGCCGATAT
                      ____________________________________________________________
consensus CAGATGTGGCATCTTGAGTTGATTACTGGGCTGGTTATAATAGTATCCTCATGCCGATAT
 
. : . : . : . : . : . :
JMSF048C20- TTACTGGTGAAAACTTGGCCAGATTTTGCTGAA
rJMSF019B20+ TTACTGTTGAAAACTTGGCCAGATTTTGCTGAATCCAGTGAAGCAGCAAATAGACAGGTT
rJMSF048C20+ TTTGCTGNATCCAGTGAAGCAGCAAATAGACAGGTT
                      ____________________________________________________________
consensus TTACTGTTGAAAACTTGGCCAGATTTTGCTGAATCCAGTGAAGCAGCAAATAGACAGGTT
 
. : . : . : . : . : . :
rJMSF019B20+ CTTACTTCTCTTGAACCTTTGGATTACATTGTCGTGTCGTTTCTTCCTGGAGTTAGTGAG
rJMSF048C20+ CTTACTTCTCTTGAACCTTTGGATTACATNGTCGTGTCGTTTCTTCCTGGAGTTAGTGAG
                      ____________________________________________________________
consensus CTTACTTCTCTTGAACCTTTGGATTACATTGTCGTGTCGTTTCTTCCTGGAGTTAGTGAG
 
. : . : . : . : . : . :
rJMSF019B20+ GAGTTTCTTTTCCGTGGTGCACTTTTGCCTCTCTTTGGTGCCAAATGGCCAAGTGCTCTG
rJMSF048C20+ GAGTTTCTTTTCCGTGGTGCACTTTTGCCTCTCTTTGGTGCCAAATGGCCAAGTGCTCTG
                      ____________________________________________________________
consensus GAGTTTCTTTTCCGTGGTGCACTTTTGCCTCTCTTTGGTGCCAAATGGCCAAGTGCTCTG
 
. : . : . : . : . : . :
rJMSF019B20+ GCCGTTGCTGCAGTCTTTGGAATATTGCACTTGGGCAGCGGCCGAAAATATTCATTTGCA
rJMSF048C20+ GCCGTTGCTGCAGTCTTTGGAATATTGCACTTGGGCAGCGGCCGAAAATATTCATTTGCA
                      ____________________________________________________________
consensus GCCGTTGCTGCAGTCTTTGGAATATTGCACTTGGGCAGCGGCCGAAAATATTCATTTGCA
 
. : . : . : . : . : . :
rJMSF019B20+ ATCTGGGCGACATTTGTGGGGCTTGCCTATGGCTATGCTACAATTTCAACATCAAGCATT
rJMSF048C20+ ATCTGGGCGACATTTGTGGGGCTTGCCTATGGCTATGCTACAATTTCAACATCAAGCATT
                      ____________________________________________________________
consensus ATCTGGGCGACATTTGTGGGGCTTGCCTATGGCTATGCTACAATTTCAACATCAAGCATT
 
. : . : . : . : . : . :
rJMSF019B20+ ATTGTGCCAATGGCTGCTCACGCTCTGAATAACTTGATCGGAGGCATCTTATGGCGCTAT
rJMSF048C20+ ATTGTGCCAATGGCTGCTCACGCTCTGAATAACTTGATCGGAGGCATCTTATGGCGCTAT
                      ____________________________________________________________
consensus ATTGTGCCAATGGCTGCTCACGCTCTGAATAACTTGATCGGAGGCATCTTATGGCGCTAT
 
. : . : . : . : . : . :
rJMSF019B20+ ACATCAAGTTCTTCGAAATAGATTGGTTTGGCCTAACGAGAATCTGTTGGAATCACGACC
rJMSF048C20+ ACATCAAGTTCTTCGAAATAGATTGGTTTGGCCTAACGAGAATCTGTTGGAATCACGACC
                      ____________________________________________________________
consensus ACATCAAGTTCTTCGAAATAGATTGGTTTGGCCTAACGAGAATCTGTTGGAATCACGACC
 
. : . : . : . : . : . :
rJMSF019B20+ CTCGAATTTAGCAAGGTTTGGCCTAACGAGAATCTGTTGGAATCACAACCCTCGAATTTA
rJMSF048C20+ CTCGAATTTAGCAAGGTTTGGCCTAACGAGAATCTGTTGGAATCACAACCCTCGAATTTA
                      ____________________________________________________________
consensus CTCGAATTTAGCAAGGTTTGGCCTAACGAGAATCTGTTGGAATCACAACCCTCGAATTTA
 
. : . : . : . : . : . :
rJMSF019B20+ GCATGAGCCTATACTCGTAACTTGATCAAGTGGAATGCATTCTCTGATACATAAACTTGC
rJMSF048C20+ GCATGAGCCTATACTCGTAACTTGATCAAGTGGAATGCATTCTCTGATACATAAACTTGC
                      ____________________________________________________________
consensus GCATGAGCCTATACTCGTAACTTGATCAAGTGGAATGCATTCTCTGATACATAAACTTGC
 
. : . : . : . : . : . :
rJMSF019B20+ CTCCACTCTAGTGTATCAGTTTGGAGCTCGGCCCTGGCTTTCAAGTATTATTCTCCTTAC
rJMSF048C20+ CTCCACTCTAGTGTATCAGTTTGGAGCTCGGCCCTGGCTTTCAAGTATTATTCTCCTTAC
                      ____________________________________________________________
consensus CTCCACTCTAGTGTATCAGTTTGGAGCTCGGCCCTGGCTTTCAAGTATTATTCTCCTTAC
 
. : . : . : . : . : . :
rJMSF019B20+ TGCCATATAGGCTTGTGTATACTTGTAGTTTT
rJMSF048C20+ TGCCATATA-GCTTGTGTATACTTGTAGTTTTTGTATTTGATTAATACTTAAAGTGCTGT
                      ____________________________________________________________
consensus TGCCATATAGGCTTGTGTATACTTGTAGTTTTTGTATTTGATTAATACTTAAAGTGCTGT
 
. : . : . : . : . : . :
rJMSF048C20+ TATTCTCAGATTTTCTCAATGTTGCTGCTTATAATTTTATCCAACTCTAGTCAACTTCTG
                      ____________________________________________________________
consensus TATTCTCAGATTTTCTCAATGTTGCTGCTTATAATTTTATCCAACTCTAGTCAACTTCTG
 
. : . : . : . : . : . :
rJMSF048C20+ ACTGGCAAGGAGTGAAGCTTCAGCTATGGATTCCATGGGGAGAATCTCCTGAAACAAACA
                      ____________________________________________________________
consensus ACTGGCAAGGAGTGAAGCTTCAGCTATGGATTCCATGGGGAGAATCTCCTGAAACAAACA