Previous Contig 013751:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023J05Sequence492001149 (3)722013751 (3)gb:AP004620_18421890.005Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P060
JMFN015J14Sequence617013751 (3)gb:AP004620_18421890.004Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P060
JMSF047P09Sequence622001149 (3)pir|T50498|T504984e-07myc-like protein - Arabidopsis thaliana>gb:ATT22D6_1555224 Arabidopsis thaliana 755013751 (3)gb:AP004620_18421890.007Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P060

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF023J05+ CAAGAAACATAGC
JMFN015J14- TTCCCTCTTTGTGGGACAAGAAACATAGC
rJMSF047P09+ AACATATTCCCTCTTTGTGGGACAAGAAACATAGC
                      ____________________________________________________________
consensus AACATATTCCCTCTTTGTGGGACAAGAAACATAGC
 
. : . : . : . : . : . :
rJMFF023J05+ ATCACAACCTCTGCCAAAACTAGTGTCTGGTAAAGACAAATCAACATCACAGCATCAACC
JMFN015J14- ATCACAACCTCTGCCAAAACTAGTGTCTGGTAAAGACAAATCAACATCACAGCATCAACC
rJMSF047P09+ ATCACAACNTCTGCCAAAACTAGTGTCTGGTAAAGACAAATCAACATCACAGCATCAACC
                      ____________________________________________________________
consensus ATCACAACCTCTGCCAAAACTAGTGTCTGGTAAAGACAAATCAACATCACAGCATCAACC
 
. : . : . : . : . : . :
rJMFF023J05+ TCAATTTCCTCAGAGTAGATCAAACACATCCAATTACACTGTTGCAAGCAATGAGCCAAA
JMFN015J14- TCAATTTCCTCAGAGTAGATCAAACACATCCAATTACACTGTTGCAAGCAATGAGCCAAA
rJMSF047P09+ TCAATTTCCTCAGAGTAGATCAAACACATCCAATTACACTGTTGCAAGCAATGAGCCAAA
                      ____________________________________________________________
consensus TCAATTTCCTCAGAGTAGATCAAACACATCCAATTACACTGTTGCAAGCAATGAGCCAAA
 
. : . : . : . : . : . :
rJMFF023J05+ AGAACAGGACCCAACTATAGAAAGTGGTACAATCAGCATTTCAAGCATCTATTCACAAGG
JMFN015J14- AGAACAGGACCCAACTATAGAAAGTGGTACAATCAGCATTTCAAGCATCTATTCACAAGG
rJMSF047P09+ AGAACAGGACCCAACTATAGAAAGTGGTACAATCAGCATTTCAAGCATCTATTCACAAGG
                      ____________________________________________________________
consensus AGAACAGGACCCAACTATAGAAAGTGGTACAATCAGCATTTCAAGCATCTATTCACAAGG
 
. : . : . : . : . : . :
rJMFF023J05+ GTTGTTAAGTACTCTCACAACCGCACTTCAGAGTTCTGGTGTAGATCTTTCGCAAGCCAG
JMFN015J14- GTTGTTAAGTACTCTCACAACCGCACTTCAGAGTTCTGGTGTAGATCTTTCGCAAGCCAG
rJMSF047P09+ GTTGTTAAGTACTCTCACAACCGCACTTCAGAGTTCTGGTGTAGATCTTTCGCAAGCCAG
                      ____________________________________________________________
consensus GTTGTTAAGTACTCTCACAACCGCACTTCAGAGTTCTGGTGTAGATCTTTCGCAAGCCAG
 
. : . : . : . : . : . :
rJMFF023J05+ CATCTCAGTACACATTGACCTTGGGAAGAGAGCAAATGGTAGATTAAATTCTTCAGCTTC
JMFN015J14- CATCTCAGTACACATTGACCTTGGGAAGAGAGCAAATGGTAGATTAAATTCTTCAGCTTC
rJMSF047P09+ CATCTCAGTACACATTGACCTTGGGAAGAGAGCAAATGGTAGATTAAATTCTTCAGCTTC
                      ____________________________________________________________
consensus CATCTCAGTACACATTGACCTTGGGAAGAGAGCAAATGGTAGATTAAATTCTTCAGCTTC
 
. : . : . : . : . : . :
rJMFF023J05+ CACAATCAAGGGAGACGATGTTTCCACGAGCAATCAACCAATTCCACATTCCATAGTCAC
JMFN015J14- CACAATCAAGGGAGACGATGTTTCCACGAGCAATCAACCAATTCCACATTCCATAGTCAC
rJMSF047P09+ CACAATCAAGGGAGACGATGTTTCCACGAGCAATCAACCAATTCCACATTCCATAGTCAC
                      ____________________________________________________________
consensus CACAATCAAGGGAGACGATGTTTCCACGAGCAATCAACCAATTCCACATTCCATAGTCAC
 
. : . : . : . : . : . :
rJMFF023J05+ AAGCGCGGGGGAGGAATCTAGCCAAGCCTTGAAAAGGATAAAAACCAGCTGAAGCTAAGC
JMFN015J14- AAGCGCGGGGGAGGAATCTAGCCAAGCCTTGAAAAGGATAAAAACCAGCTGAAGCTAAGC
rJMSF047P09+ AAGCGCGGGGGAGGAATCTAGCCAAGCCTTGAAAAGGATAAAAACCAGCTGAAGCTAAGC
                      ____________________________________________________________
consensus AAGCGCGGGGGAGGAATCTAGCCAAGCCTTGAAAAGGATAAAAACCAGCTGAAGCTAAGC
 
. : . : . : . : . : . :
rJMFF023J05+ TGACAACAAATAGAAGCATTCATTCTGTAATTGATTTATTCATTTTTTTGGGTCTACCTC
JMFN015J14- TGACAACAAATAGAAGCATTCATTCTGTAATTGATTTATTCATTTTTTTGGGTCTACCTC
rJMSF047P09+ TGACAACAAATAGAAGCATTCATTCTGTAATTGATTTATTCATTTTTTTGGGTCTACCTC
                      ____________________________________________________________
consensus TGACAACAAATAGAAGCATTCATTCTGTAATTGATTTATTCATTTTTTTGGGTCTACCTC
 
. : . : . : . : . : . :
rJMFF023J05+ TTTTCCTTCATAAGGATGATTCAAGAAATACTGGTAATATATATAGAAATCTACCCAAAC
JMFN015J14- TTTTCCTTCATAAGGATGATTCAAGAAATACTGGTAATATATATAGAAATCTACCCAAAC
rJMSF047P09+ TTTTCCTTCATAAGGATGATTCAAGAAATACTGGTAATATATATAGAAATCTACCCAAAC
                      ____________________________________________________________
consensus TTTTCCTTCATAAGGATGATTCAAGAAATACTGGTAATATATATAGAAATCTACCCAAAC
 
. : . : . : . : . : . :
rJMFF023J05+ AACATCACGAACCCACTGTACATGTAATTTATTTCTTTCTTTCTTTATCATTTTGATCTT
JMFN015J14- AACATCACGAACCCACTGTACATGTAATTTATTTCTTTCTTTCTTTAT
rJMSF047P09+ AACATCACGAACCCACTGTACATGTAATTTATTTCTTTCTTTCTTTATCATTTTGATCTT
                      ____________________________________________________________
consensus AACATCACGAACCCACTGTACATGTAATTTATTTCTTTCTTTCTTTATCATTTTGATCTT
 
. : . : . : . : . : . :
rJMFF023J05+ TAGATTGTTGGGCTGCACAGGTTGTCCCTAACAAGTGTGATATTCCTCCTTGAATTATTA
rJMSF047P09+ TAGATTGTTGGGCTGCACAGGTTGTCCCTAACAAGTGTGATATTCCTCCTTGAATTATTA
                      ____________________________________________________________
consensus TAGATTGTTGGGCTGCACAGGTTGTCCCTAACAAGTGTGATATTCCTCCTTGAATTATTA
 
. : . : . : . : . : . :
rJMFF023J05+ TTACTGTCCTGCCTGTATTCCTACTGAAACTGATTTGAGAAGCCGCGGT
rJMSF047P09+ TTACTGTCCTGCCTGTATTCCTACTGAAACTGATTTGAGAAGCCGCGGTTTAGCTAAGGC
                      ____________________________________________________________
consensus TTACTGTCCTGCCTGTATTCCTACTGAAACTGATTTGAGAAGCCGCGGTTTAGCTAAGGC