Previous Contig 013744:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS009B09Sequence563013744 (2)gb:AF020717_17616997e-21Triticum aestivum histidyl-tRNA synthetase mRNA, partial cds.
JMSF047N17Sequence643007809 (4)gb:AC084218_17333808e-10Oryza sativa (japonica cultivar-group) chromosome 5 clone P0001A07, complete seq709013744 (2)gb:AC084218_17333808e-70Oryza sativa (japonica cultivar-group) chromosome 5 clone P0001A07, complete seq

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS009B09+ GTAAAAAACCT
                      ____________________________________________________________
consensus GTAAAAAACCT
 
. : . : . : . : . : . :
JMFS009B09+ CTTTATAGTTATGAACAATAAGGTAAATTTTTAATACAATATCCCAACATCCTCACAAAA
                      ____________________________________________________________
consensus CTTTATAGTTATGAACAATAAGGTAAATTTTTAATACAATATCCCAACATCCTCACAAAA
 
. : . : . : . : . : . :
JMFS009B09+ ATGGGATACACATGGGTGAATCCAAGGAAAAAAATTAATAATTTGTTTCCTTTTTCTTTC
                      ____________________________________________________________
consensus ATGGGATACACATGGGTGAATCCAAGGAAAAAAATTAATAATTTGTTTCCTTTTTCTTTC
 
. : . : . : . : . : . :
JMFS009B09+ ATATAGGAGAACGGGAGAAGGATATGAAATTAACAAGATAAAGGCAGCACCCTTCATACC
                      ____________________________________________________________
consensus ATATAGGAGAACGGGAGAAGGATATGAAATTAACAAGATAAAGGCAGCACCCTTCATACC
 
. : . : . : . : . : . :
JMFS009B09+ TTCCAAATATGAGTGAAGACCTTAACTTAAAATTGAGTACATGCAAACTCAAAATCTACT
rJMSF047N17- AGACCTTAACTTAAAATTGAGTACATGCAAACTCAAAATCTACT
                      ____________________________________________________________
consensus TTCCAAATATGAGTGAAGACCTTAACTTAAAATTGAGTACATGCAAACTCAAAATCTACT
 
. : . : . : . : . : . :
JMFS009B09+ CCAAACCTAACATTTAGTGTCCTTAAGCCGGTTGCGAAGCTCCTCTACGAGATTATTTCT
rJMSF047N17- CCAAACCTAACATTTAGTGTCCTTAAGCCGGTTGCGAAGCTCCTCTACGAGATTATTTCT
                      ____________________________________________________________
consensus CCAAACCTAACATTTAGTGTCCTTAAGCCGGTTGCGAAGCTCCTCTACGAGATTATTTCT
 
. : . : . : . : . : . :
JMFS009B09+ AGCGACTGGGTATTCTTTAGCTGCGCTGACATCCTTTAGTTTAACAATTCCTTCACTGAG
rJMSF047N17- AGCGACTGGGTATTCTTTAGCTGCGCTGACATCCTTTAGTTTAACAATTCCTTCACTGAG
                      ____________________________________________________________
consensus AGCGACTGGGTATTCTTTAGCTGCGCTGACATCCTTTAGTTTAACAATTCCTTCACTGAG
 
. : . : . : . : . : . :
JMFS009B09+ TTCACGTTCGCCAACGATTACTATCCAAGGAATCTTTGACTCTTTGGCTCGATCAAAGTG
rJMSF047N17- TTCACGTTCGCCAACGATTACTATCCAAGGAATCTTTGACTCTTTGGCTCGATCAAAGTG
                      ____________________________________________________________
consensus TTCACGTTCGCCAACGATTACTATCCAAGGAATCTTTGACTCTTTGGCTCGATCAAAGTG
 
. : . : . : . : . : . :
JMFS009B09+ CTTGGTCACCCTTTTGTTCACCAGGAACTCGGCTTTCAGTTTTGCATCCCACAGTTCACT
rJMSF047N17- CTTGGTCACCCTTTTGTTCACCAGGAACTCGGCTTTCAGTTTTGCATCCCACAGTTCACT
                      ____________________________________________________________
consensus CTTGGTCACCCTTTTGTTCACCAGGAACTCGGCTTTCAGTTTTGCATCCCACAGTTCACT
 
. : . : . : . : . : . :
JMFS009B09+ GGCTATTTCAGATGCTAAATTAAGGTCATCACCCAGAATGCTAACAAGAACTTGAGTTTT
rJMSF047N17- GGCTATTTCAGATGCTAAATTAAGGTCATCACCCAGAATGCTAACAAGAACTTGAGTTTT
                      ____________________________________________________________
consensus GGCTATTTCAGATGCTAAATTAAGGTCATCACCCAGAATGCTAACAAGAACTTGAGTTTT
 
. : . : . : . : . : . :
JMFS009B09+ GCTTGCCCGGAC
rJMSF047N17- GCTTGCCCGGACCTCCTTGTCTTTATGGAGTTGCTCCATTATTGTAAATACTCTCTCAAT
                      ____________________________________________________________
consensus GCTTGCCCGGACCTCCTTGTCTTTATGGAGTTGCTCCATTATTGTAAATACTCTCTCAAT
 
. : . : . : . : . : . :
rJMSF047N17- TCCCAGGCTAATCCCAACTGCAGGAACCTGCTTTGTCCCAAACATTCCTATTAGATTGTC
                      ____________________________________________________________
consensus TCCCAGGCTAATCCCAACTGCAGGAACCTGCTTTGTCCCAAACATTCCTATTAGATTGTC
 
. : . : . : . : . : . :
rJMSF047N17- ATAACGTCCACCAGCAGCGATTGAACCAACCTGTGTAGCCCCTTTGAAAACAGCTTCAAA
                      ____________________________________________________________
consensus ATAACGTCCACCAGCAGCGATTGAACCAACCTGTGTAGCCCCTTTGAAAACAGCTTCAAA
 
. : . : . : . : . : . :
rJMSF047N17- TATGACTCCAGTATAGTAATCAAGACCTCTTGCAAGGCTCAAGTCAAACACAACTTTATT
                      ____________________________________________________________
consensus TATGACTCCAGTATAGTAATCAAGACCTCTTGCAAGGCTCAAGTCAAACACAACTTTATT
 
. : . : . : . : . : . :
rJMSF047N17- GATGCATTTGGACTTATCAAGAGCTTTAAACAAAATCTCCAACTCATCTAATGCAAGTAC
                      ____________________________________________________________
consensus GATGCATTTGGACTTATCAAGAGCTTTAAACAAAATCTCCAACTCATCTAATGCAAGTAC
 
. : . : . : . : . : . :
rJMSF047N17- GGATTCACTGTTATCCAAGAACTCACTACCTTCCTGTTTAAGCTTCTGTAGCAATTCCAA
                      ____________________________________________________________
consensus GGATTCACTGTTATCCAAGAACTCACTACCTTCCTGTTTAAGCTTCTGTAGCAATTCCAA