Previous Contig 013740:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF020C23Sequence649004661 (3)pir|G86161|G861616e-79hypothetical protein F10O3.9 [imported] - Arabidopsis thaliana>gb:AE005172_88932736013740 (2)gb:LEU07745_16846922e-49Lycopersicon esculentum biotin-containing subunit of methylcrotonyl-CoA carboxyl
JMSF047M20Sequence653004661 (3)pir|G86161|G861611e-80hypothetical protein F10O3.9 [imported] - Arabidopsis thaliana>gb:AE005172_88932714013740 (2)gb:LEU07745_16846923e-45Lycopersicon esculentum biotin-containing subunit of methylcrotonyl-CoA carboxyl

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF020C23+ GATGATGGGAAATTCCT
                      ____________________________________________________________
consensus GATGATGGGAAATTCCT
 
. : . : . : . : . : . :
rJMSF020C23+ AGTTGAGACAGGAGAAAGCACTTCCCCCTGTTTGGAGGTCAAAGTAGAACAGTTAAGCAA
rJMSF047M20+ GACAGGAGAAAGCACTTCCCCCTGTTTGGAGGTCAAAGTAGAACAGTTAAGCAA
                      ____________________________________________________________
consensus AGTTGAGACAGGAGAAAGCACTTCCCCCTGTTTGGAGGTCAAAGTAGAACAGTTAAGCAA
 
. : . : . : . : . : . :
rJMSF020C23+ TGAAAACTATATAGTTGAAGTAGGCGGTGTAAGACTAAATGTGAGCCTTGCCGTTTATTC
rJMSF047M20+ TGAAAACTATATAGTTGAAGTAGGCGGTGTAAGACTAAATGTGAGCCTTGCCGTTTATTC
                      ____________________________________________________________
consensus TGAAAACTATATAGTTGAAGTAGGCGGTGTAAGACTAAATGTGAGCCTTGCCGTTTATTC
 
. : . : . : . : . : . :
rJMSF020C23+ CAAGGACCATTTTAAGCACATCCACATTTGGCATGGTCAATACCATCATCACTTCAAACA
rJMSF047M20+ CAAGGACCATTTTAAGCACATCCACATTTGGCATGGTCAATACCATCATCACTTCAAACA
                      ____________________________________________________________
consensus CAAGGACCATTTTAAGCACATCCACATTTGGCATGGTCAATACCATCATCACTTCAAACA
 
. : . : . : . : . : . :
rJMSF020C23+ AAGTATAGGTGTTGAACTGTTTGATGATGATGATGAACTGCAACACAAACCTTCCAACGA
rJMSF047M20+ AAGTATAGGTGTTGAACTGTTTGATGATGATGATGAACTGCAACACAAACCTTCCAACGA
                      ____________________________________________________________
consensus AAGTATAGGTGTTGAACTGTTTGATGATGATGATGAACTGCAACACAAACCTTCCAACGA
 
. : . : . : . : . : . :
rJMSF020C23+ GTCTGCATCTCATCCTCCTGGAACTGTAGTGGGCCCCATGGCTGGTCTAGTGGTTAAAGT
rJMSF047M20+ GTCTGCATCTCATCCTCCTGGAACTGTAGTGGGCCCCATGGCTGGTCTAGTGGTTAAAGT
                      ____________________________________________________________
consensus GTCTGCATCTCATCCTCCTGGAACTGTAGTGGGCCCCATGGCTGGTCTAGTGGTTAAAGT
 
. : . : . : . : . : . :
rJMSF020C23+ TTTGGTGAAGGATGGGGAAAAAGTTCAGCAAGGCCAACCAGTTTTGGTATTAGAAGCAAT
rJMSF047M20+ TTTGGTGAAGGATGGGGAAAAAGTTCAGCAAGGCCAACCAGTTTTGGTATTAGAAGCAAT
                      ____________________________________________________________
consensus TTTGGTGAAGGATGGGGAAAAAGTTCAGCAAGGCCAACCAGTTTTGGTATTAGAAGCAAT
 
. : . : . : . : . : . :
rJMSF020C23+ GAAGATGGAGCATGTCGTGAAAGCTCCAAATACTGGCTATGTTAGTGGCCTTAAGGTTGA
rJMSF047M20+ GAAGATGGAGCATGTCGTGAAAGCTCCAAATACTGGCTATGTTAGTGGCCTTAAGGTTGA
                      ____________________________________________________________
consensus GAAGATGGAGCATGTCGTGAAAGCTCCAAATACTGGCTATGTTAGTGGCCTTAAGGTTGA
 
. : . : . : . : . : . :
rJMSF020C23+ AGTGGGCCAGCAGATTTACGATGGTGTTGCTCTCTTCAGTATCAAGGATTCTTAGATCAA
rJMSF047M20+ ATTGGGCCAGCAGATTTACGATGGTGTTGCTCTCTTCAGTATCAAGGATTCTTAGATCAA
                      ____________________________________________________________
consensus ATTGGGCCAGCAGATTTACGATGGTGTTGCTCTCTTCAGTATCAAGGATTCTTAGATCAA
 
. : . : . : . : . : . :
rJMSF020C23+ TCGGCAATTACATTGAAGACAATCTGAACTGGACTAGAAACTACAAGCAGCTCTGGAGAG
rJMSF047M20+ TCGGCAATTACATTGAAGACAATCTGAACTGGACTAGAAACTACAAGCAGCTCTGGAGAG
                      ____________________________________________________________
consensus TCGGCAATTACATTGAAGACAATCTGAACTGGACTAGAAACTACAAGCAGCTCTGGAGAG
 
. : . : . : . : . : . :
rJMSF020C23+ ATTGCAAAAGATCTCTGTATCACTTTATGCAATGATCTTGACAAGGAAATTGTACATTAG
rJMSF047M20+ ATTGCAAAAGATCTCTGTATCACTTTATGCAATGATCTTGACAAGGAAATTGTACATTAG
                      ____________________________________________________________
consensus ATTGCAAAAGATCTCTGTATCACTTTATGCAATGATCTTGACAAGGAAATTGTACATTAG
 
. : . : . : . : . : . :
rJMSF020C23+ TTGAATAGGTCAATAAAAATTCACATATGGGGGTTTGGGATTTAGTGTAGTGTTAACGAA
rJMSF047M20+ TTGAATAGGTCAATAAAAATTCACATATGGGGGTTTGGGATTTAGTGTAGTGTTAACGAA
                      ____________________________________________________________
consensus TTGAATAGGTCAATAAAAATTCACATATGGGGGTTTGGGATTTAGTGTAGTGTTAACGAA
 
. : . : . : . : . : . :
rJMSF020C23+ TTGAGCCACATTTTCAACTTATAAGGGGTTCAAATCCCATCTCCCGAATCCCCTCAAAT
rJMSF047M20+ TTGAGCCACATTTTCAACTTATAAGGGGTTCAAATCCCATCTCCCGAATCCCCTCAAATG
                      ____________________________________________________________
consensus TTGAGCCACATTTTCAACTTATAAGGGGTTCAAATCCCATCTCCCGAATCCCCTCAAATG