Previous Contig 013738:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030H22Sequence481013738 (6)gb:AB006708_15100589e-46Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYJ24.>gb:BT005261_1638693013738 (6)gb:AB006708_15100588e-56Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYJ24.>gb:BT005261_1638
JMSF039A20Sequence691013738 (6)gb:AB006708_15100585e-81Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYJ24.>gb:BT005261_1638759013738 (6)gb:AB006708_15100585e-66Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYJ24.>gb:BT005261_1638
JMSF047M17Sequence687013738 (6)gb:AB006708_15100582e-80Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYJ24.>gb:BT005261_1638746013738 (6)gb:AB006708_15100583e-54Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYJ24.>gb:BT005261_1638

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF047M17- GGATCGGCTAATCTCCCTCTTTGCTCTTTCA
JMFF030H22- ATCGGCTAATCTCCCTCTTTGCTCTTTCA
JMSF039A20- ATCGGCTAATCTCCCTCTTTGCTCTTTCA
                      ____________________________________________________________
consensus GGATCGGCTAATCTCCCTCTTTGCTCTTTCA
 
. : . : . : . : . : . :
JMSF047M17- TTTTCTTCACCACCATGCGCTGCCTCATTACGCGCAAGCTCTGGAATGGGCTCTCTGCCG
JMFF030H22- TTTTCTTCACCACCATGCGCTGCCTCATTACGCGCAAGCTCTGGAATGGGCTCTCTGCCG
JMSF039A20- TTTTCTTCACCACCATGCGCTGCCTCATTACGCGCAAGCTCTGGAATGGGCTCTCTGCCG
                      ____________________________________________________________
consensus TTTTCTTCACCACCATGCGCTGCCTCATTACGCGCAAGCTCTGGAATGGGCTCTCTGCCG
 
. : . : . : . : . : . :
JMSF047M17- CTGCCTCTCTGAGAGCTCCACCGCTTTGCGGCCAAATTCAGGCGCGTTACAGTTCTCGGC
JMFF030H22- CTGCCTCTCTGAGAGCTCCACCGCTTTGCGGCCAAATTCAGGCGCGTTACAGTTCTCGGC
JMSF039A20- CTGCCTCTCTGAGAGCTCCACCGCTTTGCGGCCAAATTCAGGCGCGTTACAGTTCTCGGC
                      ____________________________________________________________
consensus CTGCCTCTCTGAGAGCTCCACCGCTTTGCGGCCAAATTCAGGCGCGTTACAGTTCTCGGC
 
. : . : . : . : . : . :
JMSF047M17- GGTGGTATGGACTGGTTCCGATGGTAATAGAGCACTCCTCTCGAGGGGAGAGAGCCTACG
JMFF030H22- GGTGGTATGGACTGGTTCCGATGGTAATAGAGCACTCCTCTCGAGGGGAGAGAGCCTACG
JMSF039A20- GGTGGTATGGACTGGTTCCGATGGTAATAGAGCACTCCTCTCGAGGGGAGAGAGCCTACG
                      ____________________________________________________________
consensus GGTGGTATGGACTGGTTCCGATGGTAATAGAGCACTCCTCTCGAGGGGAGAGAGCCTACG
 
. : . : . : . : . : . :
JMSF047M17- ACATATTCTCGAGGCTTCTCAAGGAGCGCATAATCTGCATCAATGGTCCCATCAATGACG
JMFF030H22- ACATATTCTCGAGGCTTCTCAAGGAGCGCATAATCTGCATCAATGGTCCCATCAATGACG
JMSF039A20- ACATATTCTCGAGGCTTCTCAAGGAGCGCATAATCTGCATCAATGGTCCCATCAATGACG
                      ____________________________________________________________
consensus ACATATTCTCGAGGCTTCTCAAGGAGCGCATAATCTGCATCAATGGTCCCATCAATGACG
 
. : . : . : . : . : . :
JMSF047M17- ACACGTCCCACGTCGTTGTCGCTCAGCTCCTCTTTCTCGAGTCCGAGAACCCCTCCAAGC
JMFF030H22- ACACGTCCCACGTCGTTGTCGCTCAGCTCCTCTTTCTCGAGTCCGAGAACCCCTCCAAGC
JMSF039A20- ACACGTCCCACGTCGTTGTCGCTCAGCTCCTCTTTCTCGAGTCCGAGAACCCCTCCAAGC
rJMSF039A20+ TCTCGAGTCCGAGAACCCCTCCAAGC
                      ____________________________________________________________
consensus ACACGTCCCACGTCGTTGTCGCTCAGCTCCTCTTTCTCGAGTCCGAGAACCCCTCCAAGC
 
. : . : . : . : . : . :
JMSF047M17- CCATCCATATGTACCTCAATTCTCCTGGCGGCGCTGTCACCGCCGGTCTTGCTATATATG
JMFF030H22- CCATCCATATGTACCTCAATTCTCCTGGCGGCGCTGTCACCGCCGGTCTTGCTATATATG
JMSF039A20- CCATCCATATGTACCTCAATTCTCCTGGCGGCGCTGTCACCGCCGGTCTTGCTATATATG
rJMSF039A20+ CCATCCATATGTACCTCAATTCTCCTGGCGGCGCTGTCACCGCCGGTCTTGCTATATATG
rJMFF030H22+ TCTTGCTATATATG
rJMSF047M17+ TGTCACCGCCGGTCTTGCTATATATG
                      ____________________________________________________________
consensus CCATCCATATGTACCTCAATTCTCCTGGCGGCGCTGTCACCGCCGGTCTTGCTATATATG
 
. : . : . : . : . : . :
JMSF047M17- ATACTATGCAGTACATTCGATCTCCCATCAACACCATATGCCTAGGTCAGGCAGCATCAA
JMFF030H22- ATACTATGCAGTACATTCGATCTCCCATCAACACCATATGCCTAGGTCAGGCAGCATCAA
JMSF039A20- ATACTATGCAGTACATTCGATCTCCCATCAACACCATATGCCTAGGTCAGGCAGCATCAA
rJMSF039A20+ ATACTATGCAGTACATTCGATCTCCCATCAACACCATATGCCTAGGTCAGGCAGCATCAA
rJMFF030H22+ ATACTATGCAGTACATTCGATCTCCCATCAACACCATATGCNTAGGTCAGGCAGCATCAA
rJMSF047M17+ ATACTATGCAGTACATTCGATCTCCCATCAACACCATATGCCTAGGTCAGGCAGCATCAA
                      ____________________________________________________________
consensus ATACTATGCAGTACATTCGATCTCCCATCAACACCATATGCCTAGGTCAGGCAGCATCAA
 
. : . : . : . : . : . :
JMSF047M17- TGGGATCTCTACTTCTAGCTGCTGGAGCCAAGGGTCAGAGACGTTCTCTCCCTAATGCAA
JMFF030H22- TGGGATCTCTACTTCTAGCTGCTGGAGCCAAG
JMSF039A20- TGGGATCTCTACTTCTAGCTGCTGGAGCCAAGGGTCAGAGACGTTCTCTCCCTAATGCAA
rJMSF039A20+ TGGGATCTCTACTTCTAGCTGCTGGAGCCAAGGGTCAGAGACGTTCTCTCCCTAATGCAA
rJMFF030H22+ TGGGATCTCTACTTCTAGCTGCTGGAGCCAAGGGTCAGAGACGTTCTCTCCCTAATGCAA
rJMSF047M17+ TGGGATCTCTACTTCTAGCTGCTGGAGCCAAGGGTCAGAGACGTTCTCTCCCTAATGCAA
                      ____________________________________________________________
consensus TGGGATCTCTACTTCTAGCTGCTGGAGCCAAGGGTCAGAGACGTTCTCTCCCTAATGCAA
 
. : . : . : . : . : . :
JMSF047M17- CAATTATGATTCATCAGCCTTCTGGTGGATACAGTGGACAGGCTAAAGATATGACAATTC
JMSF039A20- CAATTATGATTCATCAGCCTTCTGGTGGATACAGTGGACAGGCTAAAGATATGACAATTC
rJMSF039A20+ CAATTATGATTCATCAGCCTTCTGGTGGATACAGTGGACAGGCTAAAGATATGACAATTC
rJMFF030H22+ CAATTATGATTCATCAGCCTTCTGGTGGATACAGTGGACAGGCTAAAGATATGACAATTC
rJMSF047M17+ CAATTATGATTCATCAGCCTTCTGGTGGATACAGTGGACAGGCTAAAGATATGACAATTC
                      ____________________________________________________________
consensus CAATTATGATTCATCAGCCTTCTGGTGGATACAGTGGACAGGCTAAAGATATGACAATTC
 
. : . : . : . : . : . :
JMSF047M17- ACACAAAACAAATTGTTCGGGTTTGGGATGCTCTAAATGAATTATACTCAAAACATACCG
JMSF039A20- ACACAAAACAAATTGTTCGGGTTTGGGATGCTCTAAATGAATTATACTCAAAACATACCG
rJMSF039A20+ ACACAAAACAAATTGTTCGGGTTTGGGATGCTCTAAATGAATTATACTCAAAACATACCG
rJMFF030H22+ ACACAAAACAAATTGTTCGGGTTTGGGATGCTCTAAATGAATTATACTCAAAACATACCG
rJMSF047M17+ ACACAAAACAAATTGTTCGGGTTTGGGATGCTCTAAATGAATTATACTCAAAACATACCG
                      ____________________________________________________________
consensus ACACAAAACAAATTGTTCGGGTTTGGGATGCTCTAAATGAATTATACTCAAAACATACCG
 
. : . : . : . : . : . :
JMSF047M17- GGCAATCAGTAGATATAATTCAGAAAAATATGGATAGAGATTATTTCATGACCCCT
JMSF039A20- GGCAATCAGTAGATATAATTCAGAAAAATATGGATAGAGATTATTTCATGACCCCTGAGG
rJMSF039A20+ GGCAATCAGTAGATATAATTCAGAAAAATATGGATAGAGATTATTTCATGACCCCTGAGG
rJMFF030H22+ GTCAATCAGTAGATATAATTCAGAAAAATATGGATAGAGATTATTTCATGACCCCTGAGG
rJMSF047M17+ GGCAATCAGTAGATATAATTCAGAAAAATATGGATAGAGATTATTTCATGACCCCTGAGG
                      ____________________________________________________________
consensus GGCAATCAGTAGATATAATTCAGAAAAATATGGATAGAGATTATTTCATGACCCCTGAGG
 
. : . : . : . : . : . :
JMSF039A20- A
rJMSF039A20+ AGGCAAAAGAATTTGGGATAATTGATGAAGTTATAGATCAAAGACCTTTGTCTCTTGTGA
rJMFF030H22+ AGGCAAAAGAATTTGGGATAATTGATGAAGTTATAGATCAAAGACCTTTGTCTCTTGTGA
rJMSF047M17+ AGGCAAAAGAATTTGGGATAATTGATGAAGTTATAGATCAAAGACCTTTGTCTCTTGTGA
                      ____________________________________________________________
consensus AGGCAAAAGAATTTGGGATAATTGATGAAGTTATAGATCAAAGACCTTTGTCTCTTGTGA
 
. : . : . : . : . : . :
rJMSF039A20+ CTGATGCTATTGCACAAGAGGACAAAGATAAGAGTTCAAACTAGAAGTCAAGGGGAACTT
rJMFF030H22+ CTGATGCTATTGCACAAGAGGACAAAGATAAGAGTTCAAACTAGAAGTCAAGGGGAACTT
rJMSF047M17+ CTGATGCTATTGCACAAGAGGACAAAGATAAGAGTTCAAACTAGAAGTCAAGGGGAACTT
                      ____________________________________________________________
consensus CTGATGCTATTGCACAAGAGGACAAAGATAAGAGTTCAAACTAGAAGTCAAGGGGAACTT
 
. : . : . : . : . : . :
rJMSF039A20+ GGTTCTTGGGGTGCATCTCGGACACGGCTATTGAGTGCCTTTTGCATTCATCAACTAACA
rJMFF030H22+ GGTTCTTGGGGTGCATCTCGGACACGGCTATTGAGTGCCTTTTGCATTCATCAACTAACA
rJMSF047M17+ GGTTCTTGGGGTGCATCTCGGACACGGCTATTGAGTGCCTTTTGCATTCATCAACTAACA
                      ____________________________________________________________
consensus GGTTCTTGGGGTGCATCTCGGACACGGCTATTGAGTGCCTTTTGCATTCATCAACTAACA
 
. : . : . : . : . : . :
rJMSF039A20+ CTGGGAATTTCTCAAAAAGCGAGTTTCATCTTATTTGGAATTCAAGTTATTGTCTTATTT
rJMFF030H22+ CTGGGAATTTCTCAAAAAGCGAGTTTCATCTTATTTGGAATTCAAGTTATTGTCTTATTT
rJMSF047M17+ CTGGGAATTTCTCAAAAAGCGAGTTTCATCTTATTTGGAATTCAAGTTATTGTCTTATTT
                      ____________________________________________________________
consensus CTGGGAATTTCTCAAAAAGCGAGTTTCATCTTATTTGGAATTCAAGTTATTGTCTTATTT
 
. : . : . : . : . : . :
rJMSF039A20+ TCTATATAGTAGGCTATGGGGCAGGCCTAGTTTTCTAGGAGGTTCATTGTCGCAAAAAAA
rJMFF030H22+ TCTATATAGTAGGCTATGGGGCAGGCCTAGTTTTCTAGGAGGTTCATTGTCGCAAAAAAA
rJMSF047M17+ TCTATATAGTAGGCTATGGGGCAGGCCTAGTTTTCTAGGAGGTTCATTGTCGCAAAAAAA
                      ____________________________________________________________
consensus TCTATATAGTAGGCTATGGGGCAGGCCTAGTTTTCTAGGAGGTTCATTGTCGCAAAAAAA
 
. : . : . : . : . : . :
rJMSF039A20+ TGGTTTAAAGTTTGGGGATGCCATTGATAAGTTGTGCCACAGCAATTATCTTTGACCATG
rJMFF030H22+ TGGTTTAAAGTTTGGGGATGCCATTGATAAGTTGTGCCACAGCAATTATCTTTGACCATG
rJMSF047M17+ TGGTTTAAAGTTTGGGGATGCCATTGATAAGTTGTGCCACAGCAATTATCTTTGACCATG
                      ____________________________________________________________
consensus TGGTTTAAAGTTTGGGGATGCCATTGATAAGTTGTGCCACAGCAATTATCTTTGACCATG
 
. : . : . : . : . : . :
rJMSF039A20+ TTAAACTTGCTTG
rJMFF030H22+ TTAAACTTGCTTG
rJMSF047M17+ TTAAACTTGCTTGTGGCGTTGTTTGTTCTATTTTTGCTATATTTATCCATTGATCTGCAC
                      ____________________________________________________________
consensus TTAAACTTGCTTGTGGCGTTGTTTGTTCTATTTTTGCTATATTTATCCATTGATCTGCAC