Previous Contig 013737:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF047M10Sequence663013737 (2)pir|T04029|T040293e-72hypothetical protein F17A8.160 - Arabidopsis thaliana>gb:ATCHRIV27_1544695 Arabi658013737 (2)gb:AY091057_15742851e-56Arabidopsis thaliana unknown protein (At4g39390) mRNA, complete cds.>gb:AY142535

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF047M10- GGCATTGGCTCCTAATCGGTAACTAACTGGAGGTCC
                      ____________________________________________________________
consensus GGCATTGGCTCCTAATCGGTAACTAACTGGAGGTCC
 
. : . : . : . : . : . :
JMSF047M10- TGAGAGATGGGATTAGCTTTTGTGAAGACTGAATTTTAGAGATTTTTGATATTTGTAGTA
                      ____________________________________________________________
consensus TGAGAGATGGGATTAGCTTTTGTGAAGACTGAATTTTAGAGATTTTTGATATTTGTAGTA
 
. : . : . : . : . : . :
JMSF047M10- AAGAAAAATGTCTTCCGCTGTCGTCAAGGATGAGAAGAAGGCGATTATTGATACAGCCGC
                      ____________________________________________________________
consensus AAGAAAAATGTCTTCCGCTGTCGTCAAGGATGAGAAGAAGGCGATTATTGATACAGCCGC
 
. : . : . : . : . : . :
JMSF047M10- ATGGACGTTTAATATTGTTACTTCTGTTGGAATTATTATTGTTAATAAGGCCCTAATGGC
                      ____________________________________________________________
consensus ATGGACGTTTAATATTGTTACTTCTGTTGGAATTATTATTGTTAATAAGGCCCTAATGGC
 
. : . : . : . : . : . :
JMSF047M10- TAATTTTGGCTTCAGCTTCGCTACAACCTTGACTGGTCTACATTTTGCCACCACTACACT
                      ____________________________________________________________
consensus TAATTTTGGCTTCAGCTTCGCTACAACCTTGACTGGTCTACATTTTGCCACCACTACACT
 
. : . : . : . : . : . :
JMSF047M10- GATGACTCTTATTCTTAAGAGGCTTGGATACATACAGGATTCCAATCTTCCATGGTCTGA
                      ____________________________________________________________
consensus GATGACTCTTATTCTTAAGAGGCTTGGATACATACAGGATTCCAATCTTCCATGGTCTGA
 
. : . : . : . : . : . :
JMSF047M10- GCGCATTAAATTTGTTTTATTTGCAAACTTCTCAATTGTTGGAATGAATGTGAGTTTGAT
                      ____________________________________________________________
consensus GCGCATTAAATTTGTTTTATTTGCAAACTTCTCAATTGTTGGAATGAATGTGAGTTTGAT
 
. : . : . : . : . : . :
JMSF047M10- GTGGAACTCTGTGGGATTCTATCAGATTGCAAAGTTGAGTATGATACCTGTCTCATGTTT
                      ____________________________________________________________
consensus GTGGAACTCTGTGGGATTCTATCAGATTGCAAAGTTGAGTATGATACCTGTCTCATGTTT
 
. : . : . : . : . : . :
JMSF047M10- ATTGGAAGTTGTGCTGGATAGTGTGCGATACTCGAGAGACACCAAGCTAAGCATTTTGTT
                      ____________________________________________________________
consensus ATTGGAAGTTGTGCTGGATAGTGTGCGATACTCGAGAGACACCAAGCTAAGCATTTTGTT
 
. : . : . : . : . : . :
JMSF047M10- GGTTCTCCTGGGTGTTGCTATCTGTACAGTTACTGATGTGAGTGTCAATGCAAAGGGATT
                      ____________________________________________________________
consensus GGTTCTCCTGGGTGTTGCTATCTGTACAGTTACTGATGTGAGTGTCAATGCAAAGGGATT
 
. : . : . : . : . : . :
JMSF047M10- TATTGCTGCCTTCATTGCGGTTTGGAGCACTGCTTTGCAGCAGTATTATGTACACTTTCT
rJMSF047M10+ TTGCTGCCTTCATTGCNNTTTNGAGCACTGCTTTGCAGCAGTATTATGTNCACTNTCT
                      ____________________________________________________________
consensus TATTGCTGCCTTCATTGCGGTTTGGAGCACTGCTTTGCAGCAGTATTATGTACACTTTCT
 
. : . : . : . : . : . :
JMSF047M10- TCAACGGAAGTACTCACTAGGATCTTT
rJMSF047M10+ TCAACGGAAGTACTCACTAGGATCTTTCAATTTATTGGGGGCATACTGCACCACTACAGG
                      ____________________________________________________________
consensus TCAACGGAAGTACTCACTAGGATCTTTCAATTTATTGGGGGCATACTGCACCACTACAGG
 
. : . : . : . : . : . :
rJMSF047M10+ CTGCATCTCTGCTGTTGGTGGGCCCGATCACAGATAAATGGTTGACTGATAAGAGTGTAG
                      ____________________________________________________________
consensus CTGCATCTCTGCTGTTGGTGGGCCCGATCACAGATAAATGGTTGACTGATAAGAGTGTAG
 
. : . : . : . : . : . :
rJMSF047M10+ GTGCCTATCACTATACTCTAAGCGCAGTGTCGTTGATCGTCCTTTCATGTACAATAGCAA
                      ____________________________________________________________
consensus GTGCCTATCACTATACTCTAAGCGCAGTGTCGTTGATCGTCCTTTCATGTACAATAGCAA
 
. : . : . : . : . : . :
rJMSF047M10+ TTGGGACGAATCTCAGCCAATTCATCTGCATTGGCAGATTTACTGCAGTTTCATTTCAAG
                      ____________________________________________________________
consensus TTGGGACGAATCTCAGCCAATTCATCTGCATTGGCAGATTTACTGCAGTTTCATTTCAAG
 
. : . : . : . : . : . :
rJMSF047M10+ TGCTTGGACACATGAAGACCATTCTTGTGTTGACTTTAGGATTCTTGTTCTTCGGGAAAG
                      ____________________________________________________________
consensus TGCTTGGACACATGAAGACCATTCTTGTGTTGACTTTAGGATTCTTGTTCTTCGGGAAAG
 
. : . : . : . : . : . :
rJMSF047M10+ AGGGTATGAATATACAAGTTGTATTGGGAATGGGTATCGCGATAGTAGGCATGGTTTGGT
                      ____________________________________________________________
consensus AGGGTATGAATATACAAGTTGTATTGGGAATGGGTATCGCGATAGTAGGCATGGTTTGGT
 
. : . : . : . : . : . :
rJMSF047M10+ ATGGTAATGCGTCATCTAAAGCTGGAGGAAAAGAGCGGGTTCAAGCAGTAGCTCGCAATG
                      ____________________________________________________________
consensus ATGGTAATGCGTCATCTAAAGCTGGAGGAAAAGAGCGGGTTCAAGCAGTAGCTCGCAATG
 
. : . : . : . : . : . :
rJMSF047M10+ AACTTAGAGCTGAAGCTGAAGTTGAAGAAAAGGAGTTGNTAGGATCGACNGAGGTTGATG
                      ____________________________________________________________
consensus AACTTAGAGCTGAAGCTGAAGTTGAAGAAAAGGAGTTGNTAGGATCGACNGAGGTTGATG
 
. : . : . : . : . : . :
rJMSF047M10+ AAAAAGTTTAAGGATGAAGAAGAAGAAAGGAAAGAAATTAAGCATGCATATCATGTAATG
                      ____________________________________________________________
consensus AAAAAGTTTAAGGATGAAGAAGAAGAAAGGAAAGAAATTAAGCATGCATATCATGTAATG
 
. : . : . : . : . : . :
rJMSF047M10+ TAGTGTTATTGTCCTGTTACTGTTTTATTTTATTTTATAATCCCATATTGAGAGTATTTT
                      ____________________________________________________________
consensus TAGTGTTATTGTCCTGTTACTGTTTTATTTTATTTTATAATCCCATATTGAGAGTATTTT