Previous Contig 013729:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN004E13Sequence593013729 (2)gb:AX128570_14617691e-83Sequence 3 from Patent WO0131025.
JMSF047K18Sequence125006125 (4)gb:AX128568_14617686e-07Sequence 1 from Patent WO0131025.627013729 (2)gb:AX128570_14617696e-62Sequence 3 from Patent WO0131025.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN004E13- CTCTTAGGTTGGATACCGGGG
                      ____________________________________________________________
consensus CTCTTAGGTTGGATACCGGGG
 
. : . : . : . : . : . :
JMFN004E13- CCACAGGTTGGAGGTGTTCTTGGTAAAGGAGGAGACCCATCACAGCCAAGGTTCACACAC
rJMSF047K18+ GACCCATCACAGCCAAGGTTNACACAC
                      ____________________________________________________________
consensus CCACAGGTTGGAGGTGTTCTTGGTAAAGGAGGAGACCCATCACAGCCAAGGTTCACACAC
 
. : . : . : . : . : . :
JMFN004E13- AATGAGTCTGGACGGTTTGAATGTCGCTTTACAAGTGTCGCAATACAAGAATCACCAGCC
rJMSF047K18+ AATGAGTCTNGACGGTTTGAATGTNGCTTTACAAGTGTCGCAATACAAGAATCNCCAGCC
                      ____________________________________________________________
consensus AATGAGTCTGGACGGTTTGAATGTCGCTTTACAAGTGTCGCAATACAAGAATCACCAGCC
 
. : . : . : . : . : . :
JMFN004E13- ATAATGTTCAAAGGGATGGAGGGTAGTACTCTAGGTGTCTGGGCAGCGCATGGTGAAGGA
rJMSF047K18+ ATAATGTTCAAAGGGATGGAGGGTAGTNCTCTAGGTGTCTGGGCAGCGCNTGGTGAAGGA
                      ____________________________________________________________
consensus ATAATGTTCAAAGGGATGGAGGGTAGTACTCTAGGTGTCTGGGCAGCGCATGGTGAAGGA
 
. : . : . : . : . : . :
JMFN004E13- AGAGCTTATTTCCCTGACGGTAGTATTTTAAATCAGGTTCTTGATTCGAACTTGGCCCCA
rJMSF047K18+ AGAGCTTATTTCCCTGACGGTAGTATTTTAAATCAGGTTCCTGNTTCGNANTTGGCCCCN
                      ____________________________________________________________
consensus AGAGCTTATTTCCCTGACGGTAGTATTTTAAATCAGGTTCTTGATTCGAACTTGGCCCCA
 
. : . : . : . : . : . :
JMFN004E13- GTGAGATATTGTGATGATGACGGTAAACCAACAGAAGTTTATCCTTTCAATCTGAATGGT
rJMSF047K18+ GTGAGATNNTGNGANGATGNCGGTAAACCAACAGAAGTTTATCCTTTCAATNTGAATGGT
                      ____________________________________________________________
consensus GTGAGATATTGTGATGATGACGGTAAACCAACAGAAGTTTATCCTTTCAATCTGAATGGT
 
. : . : . : . : . : . :
JMFN004E13- TCACCCCTCGGTGTGGCTGCAATTTGTTCTCCCAATGGGAGGCACCTTGCTATGATGCCT
rJMSF047K18+ TCNCCCCTCGGNGNGGNTGCAATTTGTTCTCCCAATGGGAGGCNCCNTGNTNTGATGCCT
                      ____________________________________________________________
consensus TCACCCCTCGGTGTGGCTGCAATTTGTTCTCCCAATGGGAGGCACCTTGCTATGATGCCT
 
. : . : . : . : . : . :
JMFN004E13- CACCCTGAGCGCTGCTTCTTGATGTGGCAGTTCCCATGGTATCCAAAGCACTGGGATGTT
rJMSF047K18+ CNCCCTGAGCGCTGCTTCTTGATGNGGCAGTTCCCNTGGTATCCAAAGCNCTGGGATGTT
                      ____________________________________________________________
consensus CACCCTGAGCGCTGCTTCTTGATGTGGCAGTTCCCATGGTATCCAAAGCACTGGGATGTT
 
. : . : . : . : . : . :
JMFN004E13- GATAAGAAAGGGCCCAGTCCTTGGTTGCGTATGTTCCAAAATGCCAGAGAATGGTGCTCA
rJMSF047K18+ GNTAAGAAAGGGCCCNGTCCTTGGTTGCGTATGTTCCNAAANGCCNGAGAATGGNGCTCA
                      ____________________________________________________________
consensus GATAAGAAAGGGCCCAGTCCTTGGTTGCGTATGTTCCAAAATGCCAGAGAATGGTGCTCA
 
. : . : . : . : . : . :
JMFN004E13- TGAGATCTTTGGTGG-CTAAAGAGGCATATTTTTTCTTTTTTTTTTTCCTGTTCCGAAAC
rJMSF047K18+ NGNGATCTTTGGTGGNCTAAAGAGGCATATTTTTTNTTTTTTTTTTTCCTGTTCCGAAAC
                      ____________________________________________________________
consensus TGAGATCTTTGGTGGNCTAAAGAGGCATATTTTTTCTTTTTTTTTTTCCTGTTCCGAAAC
 
. : . : . : . : . : . :
JMFN004E13- GCTTAACAAATCAAATCAAAAGAGCGAAGGAAG
rJMSF047K18+ GCTTAACAAATCAAATCAAAAGAGCGAAGGAAGAGCACAGTTCTAAAGTATGAGATGGAA
                      ____________________________________________________________
consensus GCTTAACAAATCAAATCAAAAGAGCGAAGGAAGAGCACAGTTCTAAAGTATGAGATGGAA
 
. : . : . : . : . : . :
rJMSF047K18+ GAAGTTATGTTGCTTAGTTTTCCCTTTTCGATGTAAATCACATAAATTNTGAATAGAAGT
                      ____________________________________________________________
consensus GAAGTTATGTTGCTTAGTTTTCCCTTTTCGATGTAAATCACATAAATTNTGAATAGAAGT