Previous Contig 013726:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF006F20Sequence441011556 (23)pir|T00555|T005553e-28hypothetical protein At2g39450 [imported] - Arabidopsis thaliana>gb:AC004218_153237013726 (4)
JMSF029A10Sequence671006554 (5)sp|O22300|HKLB_LYCES5e-25Homeobox protein knotted-1 like LET12.>pir|T04318|T04318 homeobox protein LeT12,763013726 (4)gb:AY120762_15796449e-57Arabidopsis thaliana KNAT3 homeodomain protein (At5g25220) mRNA, complete cds.>g
JMSF042J21Sequence261006554 (5)717013726 (4)gb:AY120762_15796447e-52Arabidopsis thaliana KNAT3 homeodomain protein (At5g25220) mRNA, complete cds.>g
JMSF047J24Sequence766013726 (4)gb:AY120762_15796441e-59Arabidopsis thaliana KNAT3 homeodomain protein (At5g25220) mRNA, complete cds.>g

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF042J21+ AA
                      ____________________________________________________________
consensus AA
 
. : . : . : . : . : . :
rJMSF042J21+ CTGAGAGGTCACTTATGGAGAGGGTGAGACAAGAACTTAAGCATGACCTCAAACAGGGGT
                      ____________________________________________________________
consensus CTGAGAGGTCACTTATGGAGAGGGTGAGACAAGAACTTAAGCATGACCTCAAACAGGGGT
 
. : . : . : . : . : . :
rJMSF042J21+ ACAAGGAAAAGATAGCAGACATCAGAGAGGAAATTATGCGGAAAAGAAGAGCAGGGAAGC
                      ____________________________________________________________
consensus ACAAGGAAAAGATAGCAGACATCAGAGAGGAAATTATGCGGAAAAGAAGAGCAGGGAAGC
 
. : . : . : . : . : . :
rJMSF042J21+ TGCCTGGTGATACTACATCTCTCTTAAAAGCATGGTGGCAATCGCATTCTAAATGGCCTT
rJMSF029A10+ TTAAAAGCATGGTGGCAATCGCATTCTAAATGGCCTT
rJMSF047J24+ TTAAAAGCATGGTGGCAATCGCATTCTAAATGGCCTT
                      ____________________________________________________________
consensus TGCCTGGTGATACTACATCTCTCTTAAAAGCATGGTGGCAATCGCATTCTAAATGGCCTT
 
. : . : . : . : . : . :
rJMSF042J21+ ATCCAACCGAGGAAGACAAAGCAAGATTAGTACAAGAAACTGGCTTGCAACTCAAACAGA
rJMSF029A10+ ATCCAACCGAGGAAGACAAAGCAAGATTAGTACAAGAAACTGGCTTGCAACTCAAACAGA
rJMSF047J24+ ATCCAACCGAGGAAGACAAAGCAAGATTAGTACAAGAAACTGGCTTGCAACTCAAACAGA
                      ____________________________________________________________
consensus ATCCAACCGAGGAAGACAAAGCAAGATTAGTACAAGAAACTGGCTTGCAACTCAAACAGA
 
. : . : . : . : . : . :
rJMSF042J21+ TTAACAATTGGTTCATCAACCAAAGGAAAAGAAATTGGCATACCAATCCTTCTTCTTCAT
rJMSF029A10+ TTAACAATTGGTTCATCAACCAAAGGAAAAGAAATTGGCATACCAATCCTTCTTCTTCAT
rJMSF047J24+ TTAACAATTGGTTCATCAACCAAAGGAAAAGAAATTGGCATACCAATCCTTCTTCTTCAT
                      ____________________________________________________________
consensus TTAACAATTGGTTCATCAACCAAAGGAAAAGAAATTGGCATACCAATCCTTCTTCTTCAT
 
. : . : . : . : . : . :
rJMSF042J21+ CTTCTTCTTCTCACAAGACCAAACGCAAGAGTGCAGCTGAAAAATCCAGCACCGAGCATT
rJMSF006F20+ TCACAAGACCAAACGCAAGAGTGCAGCTGAAAAATCCAGCACCGAGCATT
rJMSF029A10+ CTTCTTCTTCTCACAAGACCAAACGCAAGAGTGCAGCTGAAAAATCCAGCACCGAGCATT
rJMSF047J24+ CTTCTTCTTCTCACAAGACCAAACGCAAGAGTGCAGCTGAAAAATCCAGCACCGAGCATT
                      ____________________________________________________________
consensus CTTCTTCTTCTCACAAGACCAAACGCAAGAGTGCAGCTGAAAAATCCAGCACCGAGCATT
 
. : . : . : . : . : . :
rJMSF042J21+ TCATGTGACAACGAGATAGATCCAACAAAACAAAACATATTCCGTCTGTTTTTCTATCCA
rJMSF006F20+ TCATGTGACAACGAGATAGATCCAACAAANCAAAACATATTCCGTCTGTTTTTNTATCCA
rJMSF029A10+ TCATGTGACAACGAGATAGATCCAACAAAACAAAACATATTCCGTCTGTTTTTCTATCCA
rJMSF047J24+ TCATGTGACAACGAGATAGATCCAACAAAACAAAACATATTCCGTCTGTTTTTCTATCCA
                      ____________________________________________________________
consensus TCATGTGACAACGAGATAGATCCAACAAAACAAAACATATTCCGTCTGTTTTTCTATCCA
 
. : . : . : . : . : . :
rJMSF042J21+ AAACTACTTAAAGCAGAGCAAAGCAGAGCATACAAGATTCAAGAA-CCAAGCATTACGCC
rJMSF006F20+ AAANTNCTTAAAGCAGAGCAAAGCAGAGCATACAAGATTCAAGAATCCAAGCATTNCGCC
rJMSF029A10+ AAACTACTTAAAGCAGAGCAAAGCAGAGCATACAAGATTCAAGAA-CCAAGCATTACGCC
rJMSF047J24+ AAACTACTTAAAGCAGAGCAAAGCAGAGCATACAAGATTCAAGAA-CCAAGCATTACGCC
                      ____________________________________________________________
consensus AAACTACTTAAAGCAGAGCAAAGCAGAGCATACAAGATTCAAGAA-CCAAGCATTACGCC
 
. : . : . : . : . : . :
rJMSF042J21+ ACTGCTCACTTGTTTTCAGTTCACCAAAGGTTTGGTAAAAGTAAAATTAAACCACAGGTT
rJMSF006F20+ ACTGCTCACTTGTTTTCAGTTCACCAAAGGNTTGGCANAAGTAAAATTAAACCACAGGTT
rJMSF029A10+ ACTGCTCACTTGTTTTCAGTTCACCAAAGGTTTGGCAAAAGTAAAATTAAACCACAGGTT
rJMSF047J24+ ACTGCTCACTTGTTTTCAGTTCACCAAAGGTTTGGCAAAAGTAAAATTAAACCACAGGTT
                      ____________________________________________________________
consensus ACTGCTCACTTGTTTTCAGTTCACCAAAGGTTTGGCAAAAGTAAAATTAAACCACAGGTT
 
. : . : . : . : . : . :
rJMSF042J21+ CATCAATTCTAGTTGACTAGATTATGCTCGTGTCGTGTCCAGAATATATATATAGATTTA
rJMSF006F20+ CATCAAT
rJMSF029A10+ CATCAATTCTAGTTGACTAGATTATGCTCGTGTCGTGTCCAGAATATATATATAGATTTA
rJMSF047J24+ CATCAATTCTAGTTGACTAGATTATGCTCGTGTCGTGTCCAGAATATATATATAGATTTA
                      ____________________________________________________________
consensus CATCAATTCTAGTTGACTAGATTATGCTCGTGTCGTGTCCAGAATATATATATAGATTTA
 
. : . : . : . : . : . :
rJMSF042J21+ TGGGGGATTTCACTGGGGTACCATGTTTTTTTGTTAGCACAAGTAGGAGGTGTAGATTAT
rJMSF029A10+ TGGGGGATTTCACTGGGGTACCATGTTTTTTTGTTAGCACAAGTAGGAGGTGTAGATTAT
rJMSF047J24+ TGGGGGATTTCACTGGGGTACCATGTTTTTTTGTTAGCACAAGTAGGAGGTGTAGATTAT
                      ____________________________________________________________
consensus TGGGGGATTTCACTGGGGTACCATGTTTTTTTGTTAGCACAAGTAGGAGGTGTAGATTAT
 
. : . : . : . : . : . :
rJMSF042J21+ GGTTAGGGGCTCCAGCTAGTTTATATAATAATAATACTACTAATGTACTGCATCAA
rJMSF029A10+ GGTTAGGGGCTCCAGCTAGTTTATATAATAATAATACTACTAATGTACTGCATCAA
rJMSF047J24+ GGTTAGGGGCTCCAGCTAGTTTATATAATAATAATACTACTAATGTACTGCATCAACAAT
                      ____________________________________________________________
consensus GGTTAGGGGCTCCAGCTAGTTTATATAATAATAATACTACTAATGTACTGCATCAACAAT