Previous Contig 013725:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF014M11Sequence470007794 (3)pir|G84487|G844875e-28probable DNA replication licensing factor, mcm5 [imported] - Arabidopsis thalian805013725 (3)gb:AP003975_18358222e-93Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMSF047J15Sequence694007794 (3)pir|G84487|G844873e-63probable DNA replication licensing factor, mcm5 [imported] - Arabidopsis thalian805013725 (3)gb:AP003975_18358229e-84Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMSF050N14Sequence636007794 (3)pir|G84487|G844872e-52probable DNA replication licensing factor, mcm5 [imported] - Arabidopsis thalian751013725 (3)gb:AP003975_18358223e-83Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF014M11+ ACNAGA
                      ____________________________________________________________
consensus ACNAGA
 
. : . : . : . : . : . :
rJMSF014M11+ TAACATCGATTTGCAGACAACAATTCTTTCAAGATTTGATATGATTTNCATTGTAAAAGA
rJMSF050N14+ A
rJMSF047J15+ ATTTGATATGATTT-CATTGT-AAAGA
                      ____________________________________________________________
consensus TAACATCGATTTGCAGACAACAATTCTTTCAAGATTTGATATGATTTNCATTGTAAAAGA
 
. : . : . : . : . : . :
rJMSF014M11+ CATCAGGATGTACAGTCAAGACAAGAATATTGCTAGCCATATTGTAAGAGTTCATGTATC
rJMSF050N14+ CATCAGGATGTACAGTCAAGACAAGAATATTGCTAGCCATATTGTAAGAGTTCATGTATC
rJMSF047J15+ CATCAGGATGTNCAGTCAAGACAAGAATATTGCTAGCCATATTGTAAGAGTTCATGTATC
                      ____________________________________________________________
consensus CATCAGGATGTACAGTCAAGACAAGAATATTGCTAGCCATATTGTAAGAGTTCATGTATC
 
. : . : . : . : . : . :
rJMSF014M11+ TGCTGATGCAAGCTCGGGTGACCCAAGAACTACTAAGGAGGATAACTGGTTGAAAAGGTA
rJMSF050N14+ TGCTGATGCAAGCTCGGGTGACCCAAGAACTACTAAGGAGGATAACTGGTTGAAAAGGTA
rJMSF047J15+ TGCTGATGCAAGCTCGGGTGACCCAAGAACTACTAAGGAGGATAACTGGTTGAAAAGGTA
                      ____________________________________________________________
consensus TGCTGATGCAAGCTCGGGTGACCCAAGAACTACTAAGGAGGATAACTGGTTGAAAAGGTA
 
. : . : . : . : . : . :
rJMSF014M11+ TATACACTATTGTCGAACTATGTGTTACCCCAGGCTATCAGATTCAGCAGCTTCAATGCT
rJMSF050N14+ TATACACTATTGTCGAACTATGTGTTACCCCAGGCTATCAGATTCAGCAGCTTCAATGCT
rJMSF047J15+ TATACACTATTGTCGAACTATGTGTTACCCCAGGCTATCAGATTCAGCAGCTTCAATGCT
                      ____________________________________________________________
consensus TATACACTATTGTCGAACTATGTGTTACCCCAGGCTATCAGATTCAGCAGCTTCAATGCT
 
. : . : . : . : . : . :
rJMSF014M11+ GCAGGAGAGTCATGTCAAAATTAGACAGGATATGAGGCGGCAAGCAAATGAAGCTGGGGA
rJMSF050N14+ GCAGGAGAGTTATGTCAAAATTAGACAGGATATGAGGCGGCAAGCAAATGAAGCTGGGGA
rJMSF047J15+ GCAGGAGAGTTATGTCAAAATTAGACAGGATATGAGGCGGCAAGCAAATGAAGCTGGGGA
                      ____________________________________________________________
consensus GCAGGAGAGTTATGTCAAAATTAGACAGGATATGAGGCGGCAAGCAAATGAAGCTGGGGA
 
. : . : . : . : . : . :
rJMSF014M11+ GGCAGCTGCAATACCAATTACTGTGAGGCAACTTGAAGCTATTGTAAGGCTGAGTGAAGC
rJMSF050N14+ GGCAGCTGCAATACCAATTACTGTGAGGCAACTTGAAGCTATTGTAAGGCTGAGTGAAGC
rJMSF047J15+ GGCAGCTGCAATACCAATTACTGTGAGGCAACTTGAAGCTATTGTAAGGCTGAGTGAAGC
                      ____________________________________________________________
consensus GGCAGCTGCAATACCAATTACTGTGAGGCAACTTGAAGCTATTGTAAGGCTGAGTGAAGC
 
. : . : . : . : . : . :
rJMSF014M11+ TCTTGCAAGAATGAGACTTTCCCAAGTAGCAAACGAGAACCATGTGTCGGAAGCTATTAG
rJMSF050N14+ TCTTGCAAGAATGAGACTTTCCCAAGTAGCAAACGAGAACCATGTGTCGGAAGCTATTAG
rJMSF047J15+ TCTTGCAAGAATGAGACTTTCCCAAGTAGCAAACGAGAACCATGTGTCGGAAGCTATTAG
                      ____________________________________________________________
consensus TCTTGCAAGAATGAGACTTTCCCAAGTAGCAAACGAGAACCATGTGTCGGAAGCTATTAG
 
. : . : . : . : . : . :
rJMSF014M11+ ACTATTCAACAATTCTACCATGGATGCTGCAAAATCTGGAATTAACCAACACATAAATCT
rJMSF050N14+ ACTATTCAACAATTCTACCATGGATGCTGCAAAATCTGGAATTAACCAACACATAAATCT
rJMSF047J15+ ACTATTCAACAATTCTACCATGGATGCTGCAAAATCTGGAATTAACCAACACATAAATCT
                      ____________________________________________________________
consensus ACTATTCAACAATTCTACCATGGATGCTGCAAAATCTGGAATTAACCAACACATAAATCT
 
. : . : . : . : . : . :
rJMSF014M11+ GACGCCCGAGATGGCAAATGAGATAAAGCAAGCAGAAACCCAGATAAAGAGAAGGATGGG
rJMSF050N14+ GACGCCCGAGATGGCAAATGAGATAAAGCAAGCAGAAACCCAGATAAAGAGAAGGATGGG
rJMSF047J15+ GACGCCCGAGATGGCAAATGAGATAAAGCAAGCAGAAACCCAGATAAAGAGAAGGATGGG
                      ____________________________________________________________
consensus GACGCCCGAGATGGCAAATGAGATAAAGCAAGCAGAAACCCAGATAAAGAGAAGGATGGG
 
. : . : . : . : . : . :
rJMSF014M11+ AATCGGGAGCCACATATCCGAGAGACGGCTAATTGATGAGCTTTCTAGGATGGGCATGAA
rJMSF050N14+ AATCGGGAGCCACATATCCGAGAGACGGCTAATTGATGAGCTTTCTAGGATGGGCATGAA
rJMSF047J15+ AATCGGGAGCCACATATCCGAGAGACGGCTAATTGATGAGCTTTCTAGGATGGGCATGAA
                      ____________________________________________________________
consensus AATCGGGAGCCACATATCCGAGAGACGGCTAATTGATGAGCTTTCTAGGATGGGCATGAA
 
. : . : . : . : . : . :
rJMSF014M11+ TGAATCTATTATAAGAAGAGCTCTGTTGATTATGCATCAAAGAGACGAGGTTGAGTACAA
rJMSF050N14+ TGAATCTATTATAAGAAGAGCTCTGTTGATTATGCATCAAAGAGACGAGGTAGAGTACAA
rJMSF047J15+ TGAATCTATTATAAGAAGAGCTCTGTTGATTATGCATCAAAGAGACGAGGTTGAGTACAA
                      ____________________________________________________________
consensus TGAATCTATTATAAGAAGAGCTCTGTTGATTATGCATCAAAGAGACGAGGTTGAGTACAA
 
. : . : . : . : . : . :
rJMSF014M11+ ACGAGAAAGGAGGATCATAGTCCGCAAAGCTTGATCCTTGCTGCTGCCTGGCCTGCTTTC
rJMSF050N14+ ACGAGAAAGGAGGATCATAGTCCGCAAAGCTTGATCCTTGCTGCTGCCTGGCCTGCTTTC
rJMSF047J15+ ACGAGAAAGGAGGATCATAGTCCGCAAAGCTTGATCCTTGCTGCTGCCTGGCCTGCTTTC
                      ____________________________________________________________
consensus ACGAGAAAGGAGGATCATAGTCCGCAAAGCTTGATCCTTGCTGCTGCCTGGCCTGCTTTC
 
. : . : . : . : . : . :
rJMSF014M11+ TTCCATCTATGTATTGTTACAAAGATATATAGCATCTGATGATGATGTTTATGTTGCCAT
rJMSF050N14+ TTCCATCTATGTATTGTTACAAAGATATATAGCATCTGATGATGATGTTTATGTTGCCAT
rJMSF047J15+ TTCCATCTATGTATTGTTACAAAGATATATAGCATCTGATGATGATGTTTATGTTGCCAT
                      ____________________________________________________________
consensus TTCCATCTATGTATTGTTACAAAGATATATAGCATCTGATGATGATGTTTATGTTGCCAT
 
. : . : . : . : . : . :
rJMSF014M11+ AATCACATTGGGGCAATTT
rJMSF050N14+ AATCACATTGGGGCAATTTGTTTGTAAAAT
rJMSF047J15+ AATCACATTGGGGCAATTTGTTTGTAAAATGTTTAGATTCATAATGACAAGTATCAACCT
                      ____________________________________________________________
consensus AATCACATTGGGGCAATTTGTTTGTAAAATGTTTAGATTCATAATGACAAGTATCAACCT