Previous Contig 013724:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF023J06Sequence636007289 (3)197013724 (3)
JMSF039I06Sequence636007289 (3)583013724 (3)
JMSF047J11Sequence663007289 (3)198013724 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF039I06+ GCCCNCCCCCGTTCCNNTGGAGGTAGNGTTTGGGGCNGTTGTAGCNGA
                      ____________________________________________________________
consensus GCCCNCCCCCGTTCCNNTGGAGGTAGNGTTTGGGGCNGTTGTAGCNGA
 
. : . : . : . : . : . :
rJMSF039I06+ GAAAAAANGGGGGGAAAATNTTGATTGNGGGNTTCCNAGAAANGATTATTTTTAAGCNTT
                      ____________________________________________________________
consensus GAAAAAANGGGGGGAAAATNTTGATTGNGGGNTTCCNAGAAANGATTATTTTTAAGCNTT
 
. : . : . : . : . : . :
rJMSF039I06+ AAGGNNTTAAAGGCNTCNCNTTTTAGNGCNTGGGNTANGGTAGNGCANNGCTGNGCNGNA
                      ____________________________________________________________
consensus AAGGNNTTAAAGGCNTCNCNTTTTAGNGCNTGGGNTANGGTAGNGCANNGCTGNGCNGNA
 
. : . : . : . : . : . :
rJMSF039I06+ AANTCAANGAAGNGAGCCCTTTTTTTTTTTCCCCCCCAAAAAAGAATCAANTTTTCCCCC
                      ____________________________________________________________
consensus AANTCAANGAAGNGAGCCCTTTTTTTTTTTCCCCCCCAAAAAAGAATCAANTTTTCCCCC
 
. : . : . : . : . : . :
rJMSF039I06+ NNGGNNTGNGGGCNNGNGCANACNGNGATAGGNCCCNCCTTCCAGCNCCAATCCAANTTG
                      ____________________________________________________________
consensus NNGGNNTGNGGGCNNGNGCANACNGNGATAGGNCCCNCCTTCCAGCNCCAATCCAANTTG
 
. : . : . : . : . : . :
rJMSF039I06+ CAGNTTNTTGANGCTGNGTNTTTTGGGAANCCNTCCNTCATNTTTTATTTTNTGGGGGGG
                      ____________________________________________________________
consensus CAGNTTNTTGANGCTGNGTNTTTTGGGAANCCNTCCNTCATNTTTTATTTTNTGGGGGGG
 
. : . : . : . : . : . :
rJMSF039I06+ CCCCNCCCTAATAGTNCAAAGAAGATAGCNTACNGGNGNGATGGCTTGCCTCCNNGAAAA
rJMSF023J06+ GAAAA
rJMSF047J11+ GAAAA
                      ____________________________________________________________
consensus CCCCNCCCTAATAGTNCAAAGAAGATAGCNTACNGGNGNGATGGCTTGCCTCCNNGAAAA
 
. : . : . : . : . : . :
rJMSF039I06+ GATTTATCAAGAAAGTTGGATGGCCNTCAANGATAAGATNTTGTNTTCAAANTNTGGNTT
rJMSF023J06+ GATTTNTCNAGAAAGTTGGNNGGCCNTCAANGATAAGATNTTGTNTTCAAAGTNTGGGTT
rJMSF047J11+ GATTTNTCNAGAAAGTTGGNTGGCCNTCAANGATAAGATNTTGTNTTCAAAGTNTGGGTT
                      ____________________________________________________________
consensus GATTTATCAAGAAAGTTGGATGGCCNTCAANGATAAGATNTTGTNTTCAAAGTNTGGGTT
 
. : . : . : . : . : . :
rJMSF039I06+ TTTTTTTTTTCTTTTCTTTTTTCACCTGTGAGCTTTTGTANCTGTGAGTCCGTGAGTTGT
rJMSF023J06+ TTTTTTTTTTCTTTTCTTTTTTCACCTGTGAGCTTTTGTA-CTGTGAGTCCGTGAGTTGT
rJMSF047J11+ TTTTTTTTTTCTTTTCTTTTTTCACCTGTGAGCTTTTGTA-CTGTGAGTCCGTGAGTTGT
                      ____________________________________________________________
consensus TTTTTTTTTTCTTTTCTTTTTTCACCTGTGAGCTTTTGTA-CTGTGAGTCCGTGAGTTGT
 
. : . : . : . : . : . :
rJMSF039I06+ GGCATCTGGGTCTTTTTGAGTACTGATGGACCCTCCCTGGGTCCTTCTGCTATCA
rJMSF023J06+ GGCATCTGGGTCTTTTTGAGTACTGATGGACCCTCCCTGGGTCCTTCTGCTATCA
rJMSF047J11+ GGCATCTGGGTCTTTTTGAGTACTGATGGACCCTCCCTGGGTCCTTCTGCTATCATATGC
                      ____________________________________________________________
consensus GGCATCTGGGTCTTTTTGAGTACTGATGGACCCTCCCTGGGTCCTTCTGCTATCATATGC