Previous Contig 013722:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF047J03Sequence672013722 (2)gb:AY084504_15695938e-63Arabidopsis thaliana clone 10987 mRNA, complete sequence.753013722 (2)gb:AY093194_15751481e-12Arabidopsis thaliana unknown protein (At2g37920) mRNA, complete cds.>gb:AY128823

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF047J03- GAACATCCCATCAGCAATCAAATTTCTGGTTTTTTT
                      ____________________________________________________________
consensus GAACATCCCATCAGCAATCAAATTTCTGGTTTTTTT
 
. : . : . : . : . : . :
JMSF047J03- GAGAAAGAAAATGGCGGTCCTTCAGTCATCTTTCGCCATGAAACCAATCCAACAATCCCT
                      ____________________________________________________________
consensus GAGAAAGAAAATGGCGGTCCTTCAGTCATCTTTCGCCATGAAACCAATCCAACAATCCCT
 
. : . : . : . : . : . :
JMSF047J03- TTCATCATCCGTATCTCTTTCTTCTCCTGCAAGCCTATTCCTCGACACCAAATTCTCCCA
                      ____________________________________________________________
consensus TTCATCATCCGTATCTCTTTCTTCTCCTGCAAGCCTATTCCTCGACACCAAATTCTCCCA
 
. : . : . : . : . : . :
JMSF047J03- ACTCAGGCTGTCCCCAGCAACCACCGCCAATGTTCCCTTCAAAACGACGACGATTCGGAT
                      ____________________________________________________________
consensus ACTCAGGCTGTCCCCAGCAACCACCGCCAATGTTCCCTTCAAAACGACGACGATTCGGAT
 
. : . : . : . : . : . :
JMSF047J03- GGGTGGAGGCCCCAGGACCTATCCAGGAGGGGTTTCCAAGTGGCAGTGGAAGCGTATGCA
                      ____________________________________________________________
consensus GGGTGGAGGCCCCAGGACCTATCCAGGAGGGGTTTCCAAGTGGCAGTGGAAGCGTATGCA
 
. : . : . : . : . : . :
JMSF047J03- AATGAAGAAGTCCAAGCAGCTCCTTAAAGCCCGGCTGGCCCGTGAACGCCAGATATACGA
                      ____________________________________________________________
consensus AATGAAGAAGTCCAAGCAGCTCCTTAAAGCCCGGCTGGCCCGTGAACGCCAGATATACGA
 
. : . : . : . : . : . :
JMSF047J03- GATGCGCAAACGTACCGAGCTCAAAGCCGCCATCTCCGAGCTCGAGAGGCCATGGGAAAT
                      ____________________________________________________________
consensus GATGCGCAAACGTACCGAGCTCAAAGCCGCCATCTCCGAGCTCGAGAGGCCATGGGAAAT
 
. : . : . : . : . : . :
JMSF047J03- GGTTGAGAAGGCACCCACTTTGTTCTCCGTCAGCGCCGATGAACAACTGAAGGTATTGGC
                      ____________________________________________________________
consensus GGTTGAGAAGGCACCCACTTTGTTCTCCGTCAGCGCCGATGAACAACTGAAGGTATTGGC
 
. : . : . : . : . : . :
JMSF047J03- TGACCGGTTCCAGAGGCCGGGAGGGTTTGATATGTGGTCCGAGAAAGACGGACCCGAATT
rJMSF047J03+ TGATATGTGGTCCGAGAAAGACGGACCCGAATT
                      ____________________________________________________________
consensus TGACCGGTTCCAGAGGCCGGGAGGGTTTGATATGTGGTCCGAGAAAGACGGACCCGAATT
 
. : . : . : . : . : . :
JMSF047J03- GCTCAAATCCGAAGCTGATCTCCCCTCAGCTAGGTTTTTCCCCAAAGGTGTTGTTCATAG
rJMSF047J03+ GCTCAAATCCGAAGCTGATCTCCCCTCAGCTAGGTTTTTCCCCAAAGGTGTTGTTCATAG
                      ____________________________________________________________
consensus GCTCAAATCCGAAGCTGATCTCCCCTCAGCTAGGTTTTTCCCCAAAGGTGTTGTTCATAG
 
. : . : . : . : . : . :
JMSF047J03- CATTAAACCCTATGGAAAAGTTGAGAATATCAGTGATGGGTTTGATGATGAGAATGAAGA
rJMSF047J03+ CATTAAACCCTATGGAAAAGTTGAGAATATCAGTGATGGGTTTGATGATGAGAATGAAGA
                      ____________________________________________________________
consensus CATTAAACCCTATGGAAAAGTTGAGAATATCAGTGATGGGTTTGATGATGAGAATGAAGA
 
. : . : . : . : . : . :
JMSF047J03- TAATAGGACATTAGGAAGGAACAAATCCAGCTTCGA
rJMSF047J03+ TAATAGGACATTAGGAAGGAACAAATCCAGCTTCGAATGGGACACGGTCAAGACTAATTC
                      ____________________________________________________________
consensus TAATAGGACATTAGGAAGGAACAAATCCAGCTTCGAATGGGACACGGTCAAGACTAATTC
 
. : . : . : . : . : . :
rJMSF047J03+ TTTGAACAGGAGGGAAAGAAATGTTACTCATTCAGGTGAGCAGAATTCGAAGGGAATGCC
                      ____________________________________________________________
consensus TTTGAACAGGAGGGAAAGAAATGTTACTCATTCAGGTGAGCAGAATTCGAAGGGAATGCC
 
. : . : . : . : . : . :
rJMSF047J03+ TTACAACAATAAAAATGATAAGGTTATGAAGAATAATTTCAGGAAAGGGAACCGGAGGAA
                      ____________________________________________________________
consensus TTACAACAATAAAAATGATAAGGTTATGAAGAATAATTTCAGGAAAGGGAACCGGAGGAA
 
. : . : . : . : . : . :
rJMSF047J03+ GTATAACACTAACTTGGAGAGATTGAGTTCTGATAAAGTTAATAGTGCAAACGAATTTAG
                      ____________________________________________________________
consensus GTATAACACTAACTTGGAGAGATTGAGTTCTGATAAAGTTAATAGTGCAAACGAATTTAG
 
. : . : . : . : . : . :
rJMSF047J03+ AAGACAAAATGGGAAAACAAAATATAATCATTCCAAATCAGCAGTGTTTGATATGAGTCT
                      ____________________________________________________________
consensus AAGACAAAATGGGAAAACAAAATATAATCATTCCAAATCAGCAGTGTTTGATATGAGTCT
 
. : . : . : . : . : . :
rJMSF047J03+ GCAGAGTGATGGAAGTTATGAGTTTCAAACAGAGAATTGAGCATGTAAATTAAGTTTTAG
                      ____________________________________________________________
consensus GCAGAGTGATGGAAGTTATGAGTTTCAAACAGAGAATTGAGCATGTAAATTAAGTTTTAG
 
. : . : . : . : . : . :
rJMSF047J03+ ATGGCTGAAAATGTTGTTGAAAGTGAATTAAGGGAGTCCTGGTTGTTGAAGAATCTGCAT
                      ____________________________________________________________
consensus ATGGCTGAAAATGTTGTTGAAAGTGAATTAAGGGAGTCCTGGTTGTTGAAGAATCTGCAT
 
. : . : . : . : . : . :
rJMSF047J03+ TATGCTAGTTTTATTGAACTGAGGTTAGAAGTAATGCAGCTTTATTTGGATTGTGCACCA
                      ____________________________________________________________
consensus TATGCTAGTTTTATTGAACTGAGGTTAGAAGTAATGCAGCTTTATTTGGATTGTGCACCA
 
. : . : . : . : . : . :
rJMSF047J03+ ACCAAGCAAGATGGCAATGTTTAGAAAATATGAGGTACAGATCATCTTTGCTCCTGTAGT
                      ____________________________________________________________
consensus ACCAAGCAAGATGGCAATGTTTAGAAAATATGAGGTACAGATCATCTTTGCTCCTGTAGT
 
. : . : . : . : . : . :
rJMSF047J03+ ACTTTGTACATTACTTTTGCTTATTGACCTGTGAAATATGTATTTTAGACTAATGAGAAT
                      ____________________________________________________________
consensus ACTTTGTACATTACTTTTGCTTATTGACCTGTGAAATATGTATTTTAGACTAATGAGAAT