Previous Contig 013713:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF004B08Sequence239004579 (4)gb:AF282858_17830302e-06Mesembryanthemum crystallinum histone deacetylase (Hdeac1) mRNA, complete cds.241013713 (3)
JMSF047G12Sequence685004578 (6)gb:AP004814_18455482e-49Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P047812013713 (3)gb:AB011479_15114322e-16Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNA5.
JMSF051E16Sequence340013713 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF047G12+ TGGAAGGCACAGACAGGAGTGGTTTGAGATGAAG
                      ____________________________________________________________
consensus TGGAAGGCACAGACAGGAGTGGTTTGAGATGAAG
 
. : . : . : . : . : . :
rJMSF047G12+ ACATCTGANTCAACAAGGAGGATTAAAGGGAAGCTCTTCAAGACATCCAAAAAGCGAGGC
                      ____________________________________________________________
consensus ACATCTGANTCAACAAGGAGGATTAAAGGGAAGCTCTTCAAGACATCCAAAAAGCGAGGC
 
. : . : . : . : . : . :
rJMSF047G12+ ACGTAGATACTCTGGGAGCAAGGAAGCTATTAGCAGCAAGTATGCAGCTCTAAAGGAGCA
                      ____________________________________________________________
consensus ACGTAGATACTCTGGGAGCAAGGAAGCTATTAGCAGCAAGTATGCAGCTCTAAAGGAGCA
 
. : . : . : . : . : . :
rJMSF047G12+ GAGCAAACCTGCAGTGAATACAGAGCAAGCCAACGTGCCCTCTACTAAGGTCTCCTTGCT
                      ____________________________________________________________
consensus GAGCAAACCTGCAGTGAATACAGAGCAAGCCAACGTGCCCTCTACTAAGGTCTCCTTGCT
 
. : . : . : . : . : . :
rJMSF047G12+ CGACGCTGGCACCTCCAAACCCATTGACAGCGTAAAAGGCCCAACAGGGTTGTTGGCTGC
                      ____________________________________________________________
consensus CGACGCTGGCACCTCCAAACCCATTGACAGCGTAAAAGGCCCAACAGGGTTGTTGGCTGC
 
. : . : . : . : . : . :
rJMSF047G12+ AAGATGGGCATCAATGAAGGCAGGCCTCCAGACCTTCAAAACAAACTTAGAAGCAAAAGG
                      ____________________________________________________________
consensus AAGATGGGCATCAATGAAGGCAGGCCTCCAGACCTTCAAAACAAACTTAGAAGCAAAAGG
 
. : . : . : . : . : . :
rJMSF051E16+ GTTCCATTACGCCAATCTCAGGACACCCC
rJMSF047G12+ ATTCCCTCCTTTACGCCAAGTTGGTGAGTTCGTTCCATTACGCCAATCTCAGGACACCCC
                      ____________________________________________________________
consensus ATTCCCTCCTTTACGCCAAGTTGGTGAGTTCGTTCCATTACGCCAATCTCAGGACACCCC
 
. : . : . : . : . : . :
rJMSF051E16+ TTACNTATCTNGTCTNTCCTNATCCTCATCTGAATCTNTCGATGAGATNTTNCAAAAACT
rJMSF047G12+ TTACCTATCTCGTCTTTCCTCATCCTCATCTGAATCTCTCGATGAGATTTTCCAAAAACT
                      ____________________________________________________________
consensus TTACCTATCTCGTCTTTCCTCATCCTCATCTGAATCTCTCGATGAGATTTTCCAAAAACT
 
. : . : . : . : . : . :
rJMSF051E16+ GAAACGNCNTGGTGCAGAAGNCGACGATATCATGGATAGCAGGTAACATTCACAAAGCAA
rJMSF004B08+ CGATATCAAGGATAGCAGGTANCATTCACAAAGCAA
rJMSF047G12+ GAAACGACCTGCTGCAGAAGACGACGATATCATGGATAGCAGGTAACATTCACAAAGCAA
                      ____________________________________________________________
consensus GAAACGACCTGGTGCAGAAGACGACGATATCATGGATAGCAGGTAACATTCACAAAGCAA
 
. : . : . : . : . : . :
rJMSF051E16+ GGATGGCAACAGAAATGTACAGGCCAAGATTACAATTACACANGGTTAAAGGCTTTCTCG
rJMSF004B08+ GGATGGCAACAGAAATGTCCAGGCCAAGATTACAATTACACANGGTTAAAGGCTTTCTCG
rJMSF047G12+ GGATGGCAACAGAAATGTACAGGCCAAGATTACAATTACACATGGTTAAAGGCTTTCTCG
                      ____________________________________________________________
consensus GGATGGCAACAGAAATGTACAGGCCAAGATTACAATTACACATGGTTAAAGGCTTTCTCG
 
. : . : . : . : . : . :
rJMSF051E16+ NTAGCTTTATACTCCCAGATATAACCACGGAAGCGTATGGAAGAACACTGAAGATAAGTT
rJMSF004B08+ CTAGCTTTATACTCCCAGATATAACCACGGNAGCGTATGGAAGAACACTGAAGATAAGTT
rJMSF047G12+ CTAGCTTTATACTCCCAGATATAACCACGGAAGCGTATGGAAGAACACTGAAGATAAGTT
                      ____________________________________________________________
consensus CTAGCTTTATACTCCCAGATATAACCACGGAAGCGTATGGAAGAACACTGAAGATAAGTT
 
. : . : . : . : . : . :
rJMSF051E16+ ACTGTCCAAAATCTTAAAGTNGCAATAGATTTAACTTCCA-AGTGTTCATAATATTGTNT
rJMSF004B08+ NCTGTCCAAAA-CTTAANGTTGCAATAGATTTAACTTNCACAGTGTTCATAATATGGTTT
rJMSF047G12+ ACTGTCCAAAA-CTTAAAGTTGCAATAGATTTAACTTCCA-AGTGTTCATAATATTGTTT
                      ____________________________________________________________
consensus ACTGTCCAAAA-CTTAAAGTTGCAATAGATTTAACTTCCA-AGTGTTCATAATATTGTTT
 
. : . : . : . : . : . :
rJMSF051E16+ TCTAT
rJMSF004B08+ TCTATNNACATTATTCTTCCATACTG
rJMSF047G12+ TCTATAAACATTATTCTTCCATACTGTCCGACCGCAGCTAATCCCAATTTTGATCCACCT
                      ____________________________________________________________
consensus TCTATAAACATTATTCTTCCATACTGTCCGACCGCAGCTAATCCCAATTTTGATCCACCT
 
. : . : . : . : . : . :
rJMSF047G12+ AATAGTGCGGTTTATATCTTATGTGTAGTTTGCATACTCTTAAATCGTGGATACAAATTC
                      ____________________________________________________________
consensus AATAGTGCGGTTTATATCTTATGTGTAGTTTGCATACTCTTAAATCGTGGATACAAATTC