Previous Contig 013710:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002C13Sequence616000836 (5)gb:AY099853_15768785e-15Arabidopsis thaliana putative protein (At3g56930) mRNA, complete cds.722013710 (5)
JMFF006N01Sequence498000836 (5)gb:AY099853_15768784e-15Arabidopsis thaliana putative protein (At3g56930) mRNA, complete cds.620013710 (5)
JMFF013P12Sequence500000836 (5)gb:AY099853_15768784e-15Arabidopsis thaliana putative protein (At3g56930) mRNA, complete cds.780013710 (5)
JMFF016E19Sequence629000836 (5)gb:AY099853_15768786e-15Arabidopsis thaliana putative protein (At3g56930) mRNA, complete cds.764013710 (5)
JMSF047F12Sequence725000836 (5)gb:AY099853_15768781e-42Arabidopsis thaliana putative protein (At3g56930) mRNA, complete cds.800013710 (5)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF016E19+ GAAGGAAATGANGATAGCTGGAAAGAGAAAANTGATATTGAGCTNGGAAGTAGGT
                      ____________________________________________________________
consensus GAAGGAAATGANGATAGCTGGAAAGAGAAAANTGATATTGAGCTNGGAAGTAGGT
 
. : . : . : . : . : . :
rJMFF016E19+ TGGCAGAAGAGAATGGCATTTCACTCCCCGAAATTTTTGAGAAACTTGGAACTTGATGAG
rJMFF013P12+ AGAAACTTGGAACTTGATGAG
rJMSF047F12+ AGAAACTTGGACC-TGATGAG
                      ____________________________________________________________
consensus TGGCAGAAGAGAATGGCATTTCACTCCCCGAAATTTTTGAGAAACTTGGAACTTGATGAG
 
. : . : . : . : . : . :
rJMFF016E19+ ATAGAGGATGATTTGGAAAATATGGAAGGTAACGGGAGAAGTAACTCTGCAGATCGGGGA
rJMFF013P12+ ATAGAGGATGATTTGGAAAATATGGAAGGTAACGGGAGAAGTAACTCTGCAGATCGGGGA
rJMFF002C13+ TCTGCAGATCGGGGA
rJMSF047F12+ ATAGAGGATGATTTGGAAAATATGGAAGGTAACGGGAGAAGTAACTCTGCAGATCGGGGA
                      ____________________________________________________________
consensus ATAGAGGATGATTTGGAAAATATGGAAGGTAACGGGAGAAGTAACTCTGCAGATCGGGGA
 
. : . : . : . : . : . :
rJMFF016E19+ AGTACCGTTAGCTCAATGCACAAGATCGATATTATGGAGCAGAAAATTTCTGCAGAGAAG
rJMFF013P12+ AGTACCGTTAGCTCAATGCACAAGATCGATATTATGGAGCAGAAAATTTCTGCAGAGAAG
rJMFF002C13+ AGTACCGTTAGCTCAATGCACAAGATCGATATTATGGAGCAGAAAATTTCTGCAGAGAAG
rJMSF047F12+ AGTACCGTTAGCTCAATGCACAAGATCGATATTATGGAGCAGAAAATTTCTGCAGAGAAG
                      ____________________________________________________________
consensus AGTACCGTTAGCTCAATGCACAAGATCGATATTATGGAGCAGAAAATTTCTGCAGAGAAG
 
. : . : . : . : . : . :
rJMFF016E19+ AATGCCCTTTCCCTTCCCAACCGGTTGGATAATGTTGGCACCGAAAATAACTCCATAAAC
rJMFF013P12+ AATGCCCTTTCCCTTCCCAACCGGTTGGATAATGTTGGCACCGAAAATAACTCCATAAAC
rJMFF006N01+ GGTTGGATAATGTTNGCACCGAAAATAACTCCATAAAC
rJMFF002C13+ AATGCCCTTTCCCTTCCCAACCGGTTGGATAATGTTGGCACCGAAAATAACTCCATAAAC
rJMSF047F12+ AATGCCCTTTCCCTTCCCAACCGGTTGGATAATGTTGGCACCGAAAATAACTCCATAAAC
                      ____________________________________________________________
consensus AATGCCCTTTCCCTTCCCAACCGGTTGGATAATGTTGGCACCGAAAATAACTCCATAAAC
 
. : . : . : . : . : . :
rJMFF016E19+ AAGGATGAAAAATATAGAT-CTGATGGTGAATCGCCCTTCTATTCTCTTGAAGATGATGC
rJMFF013P12+ AAGGATGAAAAATATAGAT-CTGATGGTGAATCGCCCTTCTATTCTCTTGAAGATGATGC
rJMFF006N01+ AAGGATGAAAAATATAGATCCTGATGGTGAATCGCCCTTCTATTCTCTTGAAGATGATGC
rJMFF002C13+ AAGGATGAAAAATATAGAT-CTGATGGTGAATCGCCCTTCTATTCTCTTGAAGATGATGC
rJMSF047F12+ AAGGATGAAAAATATAGAT-CTGATGGTGAATCGCCCTTCTATTCTCTTGAAGATGATGC
                      ____________________________________________________________
consensus AAGGATGAAAAATATAGAT-CTGATGGTGAATCGCCCTTCTATTCTCTTGAAGATGATGC
 
. : . : . : . : . : . :
rJMFF016E19+ AAAAGACTCAACGTCAAGAATACCTGAACAATTATCGACCTCCAATCAAATTGAAATCCC
rJMFF013P12+ AAAAGACTCAACGTCAAGAATACCTGAACAATTATCGACCTCCAATCAAATTGAAATCCC
rJMFF006N01+ AAAAGACTCAACGTCAAGAATACCTGAACAATTATCGACCTCCAATCAAATTGAAATCCC
rJMFF002C13+ AAAAGACTCAACGTCAAGAATACCTGAACAATTATCGACCTCCAATCAAATTGAAATCCC
rJMSF047F12+ AAAAGACTCAACGTCAAGAATACCTGAACAATTATCGACCTCCAATCAAATTGAAATCCC
                      ____________________________________________________________
consensus AAAAGACTCAACGTCAAGAATACCTGAACAATTATCGACCTCCAATCAAATTGAAATCCC
 
. : . : . : . : . : . :
rJMFF016E19+ AAGTAGTCACGACAGTTTGCAGGTACAACAAATGTCATAGGGAGACTCTCCCGTGCTTTC
rJMFF013P12+ AAGTAGTCACGACAGTTTGCAGGTACAACAAATGTCATAGGGAGACTCTCCCGTGCTTTC
rJMFF006N01+ AAGTAGTCACGACAGTTTGCAGGTACAACAAATGTCATAGGGAGACTCTCCCGTGCTTTC
rJMFF002C13+ AAGTAGTCACGACAGTTTGCAGGTACAACAAATGTCATAGGGAGACTCTCCCGTGCTTTC
rJMSF047F12+ AAGTAGTCACGACAGTTTGCAGGTACAACAAATGTCATAGGGAGACTCTCCCGTGCTTTC
                      ____________________________________________________________
consensus AAGTAGTCACGACAGTTTGCAGGTACAACAAATGTCATAGGGAGACTCTCCCGTGCTTTC
 
. : . : . : . : . : . :
rJMFF016E19+ CACAACCCAGGTATTATACACATAAGCAGAGAATCTCTCTCTCGATCATCTTGCCTTTGG
rJMFF013P12+ CACAACCCAGGTATTATACACATAAGCAGAGAATCTCTCTCTCGATCATCTTGCCTTTGG
rJMFF006N01+ CACAACCCAGGTATTATACACATAAGCAGAGAATCTCTCTCTCGATCATCTTGCCTTTGG
rJMFF002C13+ CACAACCCAGGTATTATACACATAAGCAGAGAATCTCTCTCTCGATCATCTTGCCTTTGG
rJMSF047F12+ CACAACCCAGGTATTATACACATAAGCAGAGAATCTCTCTCTCGATCATCTTGCCTTTGG
                      ____________________________________________________________
consensus CACAACCCAGGTATTATACACATAAGCAGAGAATCTCTCTCTCGATCATCTTGCCTTTGG
 
. : . : . : . : . : . :
rJMFF016E19+ TGGGGCGGGCTTTTAAGGCCGGCCCGGGATTCCAGATTAGAAGATTTGCTTGTGGGTTGG
rJMFF013P12+ TGGGGCGGGCTTTTAAGGCCGGCCCGGGATTCCAGATTAGAAGATTTGCTTGTGGGTTGG
rJMFF006N01+ TGGGGCGGGCTTTTAAGGCCGGCCCGGGATTCCAGATTAGAAGATTTGCTTGTGGGTTGG
rJMFF002C13+ TGGGGCGGGCTTTTAAGGCCGGCCCGGGATTCCAGATTAGAAGATTTGCTTGTGGGTTGG
rJMSF047F12+ TGGGGCGGGCTTTTAAGGCCGGCCCGGGATTCCAGATTAGAAGATTTGCTTGTGGGTTGG
                      ____________________________________________________________
consensus TGGGGCGGGCTTTTAAGGCCGGCCCGGGATTCCAGATTAGAAGATTTGCTTGTGGGTTGG
 
. : . : . : . : . : . :
rJMFF016E19+ TTGCGGGTTATATTAGACAATTGAGTGGTGCTGACATGGTGAATAAAGTGTAGGATCTTG
rJMFF013P12+ TTGCGGGTTATATTAGACAATTGAGTGGTGCTGACATGGTGAATAAAGTGTAGGATCTTG
rJMFF006N01+ TTGCGGGTTATATTAGACAATTGAGTGGTGCTGACATGGTGAATAAAGTGTAGGATCTTG
rJMFF002C13+ TTGCGGGTTATATTAGACAATTGAGTGGTGCTGACATGGTGAATAAAGTGTAGGATCTTG
rJMSF047F12+ TTGCGGGTTATATTAGACAATTGAGTGGTGCTGACATGGTGAATAAAGTGTAGGATCTTG
                      ____________________________________________________________
consensus TTGCGGGTTATATTAGACAATTGAGTGGTGCTGACATGGTGAATAAAGTGTAGGATCTTG
 
. : . : . : . : . : . :
rJMFF016E19+ ATCCTCGTCGTCGTGAAAATTACATTTATTGATGAGTGGATGTATAGTTATTTGTTGAAC
rJMFF013P12+ ATCCTCGTCGTCGTGAAAATTACATTTATTGATGAGTGGATGTATAGTTATTTGTTGAAC
rJMFF006N01+ ATCCTCGTCGTCGTGAAAATTACATTTATTGATGAGTGGATGTATAGTTATTTGTTGAAC
rJMFF002C13+ ATCCTCGTCGTCGTGAAAATTACATTTATTGATGAGTGGATGTATAGTTATTTGTTGAAC
rJMSF047F12+ ATCCTCGTCGTCGTGAAAATTACATTTATTGATGAGTGGATGTATAGTTATTTGTTGAAC
                      ____________________________________________________________
consensus ATCCTCGTCGTCGTGAAAATTACATTTATTGATGAGTGGATGTATAGTTATTTGTTGAAC
 
. : . : . : . : . : . :
rJMFF016E19+ CTCTCCTCATTGTTCATTGTGTGAGTATCTGAAATTCATGGCCAAAGACT
rJMFF013P12+ CTCTCCTCATTGTTCATTGTGTGAGTATCTGAAATTCATGGCCAAAGACTACATGGTTTG
rJMFF006N01+ CTCTCCTCATTGTTCATTGTGTGAGTATCTGAAATTCATGGCCAAAGACTACATGGTTTG
rJMFF002C13+ CTCTCCTCATTGTTCATTGTGTGAGTATCTGAAATTCATGGCCAAAGACTACATGGTTTG
rJMSF047F12+ CTCTCCTCATTGTTCATTGTGTGAGTATCTGAAATTCATGGCCAAAGACTACATGGTTTG
                      ____________________________________________________________
consensus CTCTCCTCATTGTTCATTGTGTGAGTATCTGAAATTCATGGCCAAAGACTACATGGTTTG
 
. : . : . : . : . : . :
rJMFF013P12+ AAGGCTAAGGTTGATCTGTTATAAGAAAACAAGAAATACTAACCTCAGAACCTGGTTTGT
rJMFF006N01+ AAGGCTAAGGTTGATCTGTTATAAGAAAACAAGAAATACTAACCTCAGAACCTGGTTTGT
rJMFF002C13+ AAGGCTAAGGTTGATCTGTTATAAGAAAACAAGAAATACTAACCTCAGAACCTGGTTTGT
rJMSF047F12+ AAGGCTAAGGTTGATCTGTTATAAGAAAACAAGAAATACTAACCTCAGAACCTGGTTTGT
                      ____________________________________________________________
consensus AAGGCTAAGGTTGATCTGTTATAAGAAAACAAGAAATACTAACCTCAGAACCTGGTTTGT
 
. : . : . : . : . : . :
rJMFF013P12+ GTCTATGAGTTTTGCCAAATGCAGCAAAAGATCAAAGGAT
rJMFF006N01+ GTCTATGAGTTTTGCCAAATGCAGCAAAAGATCAAAGGAT
rJMFF002C13+ GTCTATGAGTTTTGCCAAATGCAGCAAAAGATCAAAGGATGG
rJMSF047F12+ GTCTATGAGTTTTGCCAAATGCAGCAAAAGATCAAAGGATGGTGTAATATTCATGCTGGT
                      ____________________________________________________________
consensus GTCTATGAGTTTTGCCAAATGCAGCAAAAGATCAAAGGATGGTGTAATATTCATGCTGGT