Previous Contig 013702:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF012J03Sequence230013702 (6)742013702 (6)gb:AF443601_18003323e-74Oryza sativa clathrin assembly protein AP17-like protein mRNA, complete cds.
JMSF018O13Sequence465013702 (6)gb:AF443601_18003327e-48Oryza sativa clathrin assembly protein AP17-like protein mRNA, complete cds.737013702 (6)gb:AF443601_18003323e-74Oryza sativa clathrin assembly protein AP17-like protein mRNA, complete cds.
JMSF047D18Sequence716013702 (6)gb:AF443601_18003323e-74Oryza sativa clathrin assembly protein AP17-like protein mRNA, complete cds.738013702 (6)gb:AF443601_18003323e-74Oryza sativa clathrin assembly protein AP17-like protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF012J03- GATTGAGTTTTTACGCCAGTCTCGATC
JMSF018O13- GAGTTTTTACGCCAGTCTCGATC
JMSF047D18- GAGTTTTTACGCCAGTCTCGATC
                      ____________________________________________________________
consensus GATTGAGTTTTTACGCCAGTCTCGATC
 
. : . : . : . : . : . :
JMSF012J03- GTCGACTCTGAACTCTGACTTCTCGTCGCAGTCGGACCCGAATCTCCAGCCACCGCTCTC
JMSF018O13- GTCGACTCTGAACTCTGACTTCTCGTCGCAGTCGGACCCGAATCTCCAGCCACCGCTCTC
JMSF047D18- GTCGACTCTGAACTCTGACTTCTCGTCGCAGTCGGACCCGAATCTCCAGCCACCGCTCTC
                      ____________________________________________________________
consensus GTCGACTCTGAACTCTGACTTCTCGTCGCAGTCGGACCCGAATCTCCAGCCACCGCTCTC
 
. : . : . : . : . : . :
JMSF012J03- CCGGCGGCGGAGGAGGGAAGGAAAAAGCTTCTGATTTCCTTTTAGCGCGAGCTTGAATCA
JMSF018O13- CCGGCGGCGGAGGAGGGAAGGAAAAAGCTTCTGATTTCCTTTTAGCGCGAGCTTGAATCA
JMSF047D18- CCGGCGGCGGAGGAGGGAAGGAAAAAGCTTCTGATTTCCTTTTAGCGCGAGCTTGAATCA
rJMSF018O13+ TAGCGCGAGCTTGAATCA
rJMSF012J03+ CCTTTTAGCGCGAGCTTGAATCA
rJMSF047D18+ TAGCGCGAGCTTGAATCA
                      ____________________________________________________________
consensus CCGGCGGCGGAGGAGGGAAGGAAAAAGCTTCTGATTTCCTTTTAGCGCGAGCTTGAATCA
 
. : . : . : . : . : . :
JMSF012J03- ACTCAAGCACTTGTTTTGTGCTAGTTTATACTCTGAAAATGATCCGATTCATACTGCTCC
JMSF018O13- ACTCAAGCACTTGTTTTGTGCTAGTTTATACTCTGAAAATGATCCGATTCATACTGCTCC
JMSF047D18- ACTCAAGCACTTGTTTTGTGCTAGTTTATACTCTGAAAATGATCCGATTCATACTGCTCC
rJMSF018O13+ ACTCAAGCACTTGTTTTGTGCTAGTTTATACTCTGAAAATGATCCGATTCATACTGCTCC
rJMSF012J03+ ACTCAAGCACTTGTTTTGTGCTAGNTTATACTCTGAAAATGATCCGATTCATACTGCTCC
rJMSF047D18+ ACTCAAGCACTTGTTTTGTGCTAGTTTATACTCTGAAAATGATCCGATTCATACTGCTCC
                      ____________________________________________________________
consensus ACTCAAGCACTTGTTTTGTGCTAGTTTATACTCTGAAAATGATCCGATTCATACTGCTCC
 
. : . : . : . : . : . :
JMSF012J03- AGAACCGGCAAGGTAAGACTCGA
JMSF018O13- AGAACCGGCAAGGTAAGACTCGATTGGCCAAGTATTACATTCCTCTGGAGGAATCCGAGA
JMSF047D18- AGAACCGGCAAGGTAAGACTCGATTGGCCAAGTATTACATTCCTCTGGAGGAATCCGAGA
rJMSF018O13+ AGAACCGGCAAGGTAAGACTCGATTGGCCAAGTATTACATTCCTCTGGAGGAATCCGAGA
rJMSF012J03+ AGAACCGGCAAGGTAAGACTCGATTGGCCAAGTATTACATTCCTCTGGAGGAATCCGAGA
rJMSF047D18+ AGAACCGGCAAGGTAAGACTCGATTGGCCAAGTATTACATTCCTCTGGAGGAATCCGAGA
                      ____________________________________________________________
consensus AGAACCGGCAAGGTAAGACTCGATTGGCCAAGTATTACATTCCTCTGGAGGAATCCGAGA
 
. : . : . : . : . : . :
JMSF018O13- AGCACAAAGTCGAATACGAGGTTCACAGATTGGTTGTGAACAGAGATCCCAAATTCACCA
JMSF047D18- AGCACAAAGTCGAATACGAGGTTCACAGATTGGTTGTGAACAGAGATCCCAAATTCACCA
rJMSF018O13+ AGCACAAAGTCGAATACGAGGTTCACAGATTGGTTGTGAACAGAGATCCCAAATTCACCA
rJMSF012J03+ AGCACAAAGTCGAATACGAGGTTCACAGATTGGTTGTGAACAGAGATCCCAAATTCACCA
rJMSF047D18+ AGCACAAAGTCGAATACGAGGTTCACAGATTGGTTGTGAACAGAGATCCCAAATTCACCA
                      ____________________________________________________________
consensus AGCACAAAGTCGAATACGAGGTTCACAGATTGGTTGTGAACAGAGATCCCAAATTCACCA
 
. : . : . : . : . : . :
JMSF018O13- ACTTCGTCGAGTTCCGGACCTACAAGATAATCTACAGGCGATATGCGGGATTGTTTTTCT
JMSF047D18- ACTTCGTCGAGTTCCGGACCTACAAGATAATCTACAGGCGATATGCGGGATTGTTTTTCT
rJMSF018O13+ ACTTCGTCGAGTTCCGGACCTACAAGATAATCTACAGGCGATATGCGGGATTGTTTTTCT
rJMSF012J03+ ACTTCGTCGAGTTCCGGACCTACAAGATAATCTACAGGCGATATGCGGGATTGTTTTTCT
rJMSF047D18+ ACTTCGTCGAGTTCCGGACCTACAAGATAATCTACAGGCGATATGCGGGATTGTTTTTCT
                      ____________________________________________________________
consensus ACTTCGTCGAGTTCCGGACCTACAAGATAATCTACAGGCGATATGCGGGATTGTTTTTCT
 
. : . : . : . : . : . :
JMSF018O13- CGCTCTGTGTTGATATAACAGACAATGAGTTGGCTTATTTGGAGTGCATCCACTTATTTG
JMSF047D18- CGCTCTGTGTTGATATAACAGACAATGAGTTGGCTTATTTGGAGTGCATCCACTTATTTG
rJMSF018O13+ CGCTCTGTGTTGATATAACAGACAATGAGTTGGCTTATTTGGAGTGCATCCACTTATTTG
rJMSF012J03+ CGCTCTGTGTTGATATAACAGACAATGAGTTGGCTTATTTGGAGTGCATCCACTTATTTG
rJMSF047D18+ CGCTCTGTGTTGATATAACAGACAATGAGTTGGCTTATTTGGAGTGCATCCACTTATTTG
                      ____________________________________________________________
consensus CGCTCTGTGTTGATATAACAGACAATGAGTTGGCTTATTTGGAGTGCATCCACTTATTTG
 
. : . : . : . : . : . :
JMSF018O13- TGGAGATTTTGGATCACTTCT
JMSF047D18- TGGAGATTTTGGATCACTTCTTCAGCAATGTTTGCGAGTTAGATTTGGTTTTTAACTTTC
rJMSF018O13+ TGGAGATTTTGGATCACTTCTTCAGCAATGTTTGCGAGTTAGATTTGGTTTTTAACTTTC
rJMSF012J03+ TGGAGATTTTGGATCACTTCTTCAGCAATGTTTGCGAGTTAGATTTGGTTTTTAACTTTC
rJMSF047D18+ TGGAGATTTTGGATCACTTCTTCAGCAATGTTTGCGAGTTAGATTTGGTTTTTAACTTTC
                      ____________________________________________________________
consensus TGGAGATTTTGGATCACTTCTTCAGCAATGTTTGCGAGTTAGATTTGGTTTTTAACTTTC
 
. : . : . : . : . : . :
JMSF047D18- ACAAGGTATATCTGATTCTGGATGAGTTCATTCTTGCTGGGGAGCTCCAAGAAACAAGTA
rJMSF018O13+ ACAAGGTATATCTGATTCTGGATGAGTTCATTCTTGCTGGGGAGCTCCAAGAAACAAGTA
rJMSF012J03+ ACAAGGTATATCTGATTCTGGATGAGTTCATTCTTGCTGGGGAGCTCCAAGAAACAAGTA
rJMSF047D18+ ACAAGGTATATCTGATTCTGGATGAGTTCATTCTTGCTGGGGAGCTCCAAGAAACAAGTA
                      ____________________________________________________________
consensus ACAAGGTATATCTGATTCTGGATGAGTTCATTCTTGCTGGGGAGCTCCAAGAAACAAGTA
 
. : . : . : . : . : . :
JMSF047D18- AGAAGGCCATCATAGAGAGAATGGGTGAACTGGAAAAGCAGGAATGAAGGCTCATGGCAC
rJMSF018O13+ AGAAGGCCATCATAGAGAGAATGGGTGAACTGGAAAAGCAGGAATGAAGGCTCATGGCAC
rJMSF012J03+ AGAAGGCCATCATAGAGAGAATGGGTGAACTGGAAAAGCAGGAATGAAGGCTCATGGCAC
rJMSF047D18+ AGAAGGCCATCATAGAGAGAATGGGTGAACTGGAAAAGCAGGAATGAAGGCTCATGGCAC
                      ____________________________________________________________
consensus AGAAGGCCATCATAGAGAGAATGGGTGAACTGGAAAAGCAGGAATGAAGGCTCATGGCAC
 
. : . : . : . : . : . :
JMSF047D18- CCTGTTTTCACTTTTATCTGGCATCAACAATATATGGCACCTCTGTTGTCACCAGACTGA
rJMSF018O13+ CCTGTTTTCACTTTTATCTGGCATCAACAATATATGGCACCTCTGTTGTCACCAGACTGA
rJMSF012J03+ CCTGTTTTCACTTTTATCTGGCATCAACAATATATGGCACCTCTGTTGTCACCAGACTGA
rJMSF047D18+ CCTGTTTTCACTTTTATCTGGCATCAACAATATATGGCACCTCTGTTGTCACCAGACTGA
                      ____________________________________________________________
consensus CCTGTTTTCACTTTTATCTGGCATCAACAATATATGGCACCTCTGTTGTCACCAGACTGA
 
. : . : . : . : . : . :
JMSF047D18- ATTTTATTGAATACCATTTACCCATCTGA
rJMSF018O13+ ATTTTATTGAATACCATTTACCCATCTGATTTTGTCTTTGTGCTTATTGTAATTCTGTTT
rJMSF012J03+ ATTTTATTGAATACCATTTACCCATCTGATTTTGTCTTTGTGCTTATTGTAATTCTGTTT
rJMSF047D18+ ATTTTATTGAATACCATTTACCCATCTGATTTTGTCTTTGTGCTTATTGTAATTCTGTTT
                      ____________________________________________________________
consensus ATTTTATTGAATACCATTTACCCATCTGATTTTGTCTTTGTGCTTATTGTAATTCTGTTT
 
. : . : . : . : . : . :
rJMSF018O13+ GATTGCCCAGCATTTGTTTGCACTTTACATGTAAAGGAGGTTGAATACTGAAATTACAAG
rJMSF012J03+ GATTGCCCAGCATTTGTTTGCACTTTACATGTAAAGGAGGTTGAATACTGAAATTACAAG
rJMSF047D18+ GATTGCCCAGCATTTGTTTGCACTTTACATGTAAAGGAGGTTGAATACTGAAATTACAAG
                      ____________________________________________________________
consensus GATTGCCCAGCATTTGTTTGCACTTTACATGTAAAGGAGGTTGAATACTGAAATTACAAG
 
. : . : . : . : . : . :
rJMSF018O13+ TCTTCTGAGTTTTGTAATCTCATCTGAAAGAACCAGTTTGCCAATGCTCACACAATATT
rJMSF012J03+ TCTTCTGAGTTTTGTAATCTCATCTGAAAGAACCAGTTTGCCAATGCTCACACAATATT
rJMSF047D18+ TCTTCTGAGTTTTGTAATCTCATCTGAAAGAACCAGTTTGCCAATGCTCACACAATATTG
                      ____________________________________________________________
consensus TCTTCTGAGTTTTGTAATCTCATCTGAAAGAACCAGTTTGCCAATGCTCACACAATATTG