Previous Contig 013697:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019D08Sequence567008093 (15)gb:AF216497_17780857e-72Gossypium hirsutum P-glycoprotein (CMDR1) mRNA, complete cds.743013697 (3)gb:AF216497_1778085e-107Gossypium hirsutum P-glycoprotein (CMDR1) mRNA, complete cds.
JMSF047C13Sequence682008093 (15)gb:AF216497_17780851e-45Gossypium hirsutum P-glycoprotein (CMDR1) mRNA, complete cds.761013697 (3)gb:AF216497_1778085e-107Gossypium hirsutum P-glycoprotein (CMDR1) mRNA, complete cds.
JMSF052C15Sequence672008093 (15)gb:AF216497_17780851e-43Gossypium hirsutum P-glycoprotein (CMDR1) mRNA, complete cds.896013697 (3)gb:AF216497_1778085e-128Gossypium hirsutum P-glycoprotein (CMDR1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052C15+ CCAAATGGTGGCATCCGTGTTTGAAGTACTAGATCGCAAGACAGAGATCTTAGCTG
                      ____________________________________________________________
consensus CCAAATGGTGGCATCCGTGTTTGAAGTACTAGATCGCAAGACAGAGATCTTAGCTG
 
. : . : . : . : . : . :
rJMSF052C15+ ATGTGGGGGAGGAGTTGATAAAAGTGGAAGGCACAATTGAGCTCAGGGATGTGGAGTTTA
                      ____________________________________________________________
consensus ATGTGGGGGAGGAGTTGATAAAAGTGGAAGGCACAATTGAGCTCAGGGATGTGGAGTTTA
 
. : . : . : . : . : . :
rJMSF052C15+ GCTACCCTTCCCGGCCTGATACTCCGATTTTCAAAGATTTCAACATGAGAGTGCGCCCGG
rJMFF019D08+ TTCAAAGATTTCAACATGAGAGTGCGCCCGG
rJMSF047C13+ TACTCCGATTTTCAAAGATTTCAACATGAGAGTGCGCCCGG
                      ____________________________________________________________
consensus GCTACCCTTCCCGGCCTGATACTCCGATTTTCAAAGATTTCAACATGAGAGTGCGCCCGG
 
. : . : . : . : . : . :
rJMSF052C15+ GCAAGAGCATGGCGTTAGTCGGGCAGAGTGGTTCTGGTAAAAGTTCGGTTATCTCTCTCA
rJMFF019D08+ GCAAGAGCATGGCGTTAGTCGGGCAGAGTGGTTCTGGTAAAAGTTCGGTTATCTCTCTCA
rJMSF047C13+ GCAAGAGCATGGCGTTAGTCGGGCAGAGTGGTTCTGGTAAAAGTTCGGTTATCTCTCTCA
                      ____________________________________________________________
consensus GCAAGAGCATGGCGTTAGTCGGGCAGAGTGGTTCTGGTAAAAGTTCGGTTATCTCTCTCA
 
. : . : . : . : . : . :
rJMSF052C15+ TTTTGAGGTTTTATGATCCAATATCCGGGAAAGTCATGATTGATGGTAAAGATATCAAGA
rJMFF019D08+ TTTTGAGGTTTTATGATCCAATATCCGGGAAAGTCATGATTGATGGTAAAGATATCAAGA
rJMSF047C13+ TTTTGAGGTTTTATGATCCAATATCCGGGAAAGTCATGATTGATGGTAAAGATATCAAGA
                      ____________________________________________________________
consensus TTTTGAGGTTTTATGATCCAATATCCGGGAAAGTCATGATTGATGGTAAAGATATCAAGA
 
. : . : . : . : . : . :
rJMSF052C15+ ACCTAAAGCTCAAGTCTCTAAGGAAGCACATTGGACTTGTCCAACAAGAACCTGCCCTTT
rJMFF019D08+ ACCTAAAGCTCAAGTCTCTAAGGAAGCACATTGGACTTGTCCAACAAGAACCTGCCCTTT
rJMSF047C13+ ACCTAAAGCTCAAGTCTCTAAGGAAGCACATTGGACTTGTCCAACAAGAACCTGCCCTTT
                      ____________________________________________________________
consensus ACCTAAAGCTCAAGTCTCTAAGGAAGCACATTGGACTTGTCCAACAAGAACCTGCCCTTT
 
. : . : . : . : . : . :
rJMSF052C15+ TCGCCACATCGATCTACGAAAACATCCTCTATGGCAAAGAGGGAGCAACCGAGTCAGAAG
rJMFF019D08+ TCGCCACATCGATCTACGAAAACATCCTCTATGGCAAAGAGGGAGCAACCGAGTCAGAAG
rJMSF047C13+ TCGCCACATCGATCTACGAAAACATCCTCTATGGCAAAGAGGGAGCAACCGAGTCAGAAG
                      ____________________________________________________________
consensus TCGCCACATCGATCTACGAAAACATCCTCTATGGCAAAGAGGGAGCAACCGAGTCAGAAG
 
. : . : . : . : . : . :
rJMSF052C15+ TGATAGAAGCCGCAAAGCTAGCCAATGCGCATAGTTTCATTAGTGCTCTCCCCGAGGGCT
rJMFF019D08+ TGATAGAAGCCGCAAAGCTAGCCAATGCGCATAGTTTCATTAGTGCTCTCCCCGAGGGCT
rJMSF047C13+ TGATAGAAGCCGCAAAGCTAGCCAATGCGCATAGTTTCATTAGTGCTCTCCCCGAGGGCT
                      ____________________________________________________________
consensus TGATAGAAGCCGCAAAGCTAGCCAATGCGCATAGTTTCATTAGTGCTCTCCCCGAGGGCT
 
. : . : . : . : . : . :
rJMSF052C15+ ACTCGACCAAGGTAGGAGAGCGAGGCGTGCAGCTTTCTGGCGGGCAGAAGCAGCGAGTAG
rJMFF019D08+ ACTCGACCAAGGTAGGAGAGCGAGGCGTGCAGCTTTCTGGCGGGCAGAAGCAGCGAGTAG
rJMSF047C13+ ACTCGACCAAGGTAGGAGAGCGAGGCGTGCAGCTTTCTGGCGGGCAGAAGCAGCGAGTAG
                      ____________________________________________________________
consensus ACTCGACCAAGGTAGGAGAGCGAGGCGTGCAGCTTTCTGGCGGGCAGAAGCAGCGAGTAG
 
. : . : . : . : . : . :
rJMSF052C15+ CCATAGCCCGAGCCGTCCTAAAGAACCCCGAAATCTTGCTATTGGACGAAGCCACTAGTG
rJMFF019D08+ CCATAGCCCGAGCCGTCCTAAAGAACCCCGAAATCTTGCTATTGGACGAAGCCACTAGTG
rJMSF047C13+ CCATAGCCCGAGCCGTCCTAAAGAACCCCGAAATCTTGCTATTGGACGAAGCCACTAGTG
                      ____________________________________________________________
consensus CCATAGCCCGAGCCGTCCTAAAGAACCCCGAAATCTTGCTATTGGACGAAGCCACTAGTG
 
. : . : . : . : . : . :
rJMSF052C15+ CACTCGACGTCGAGTCAGAGCGAATCGTCCAACAAGCTCTCGACAGGCTGATGAAGAGCA
rJMFF019D08+ CACTCGACGTCGAGTCAGAGCGAATCGTCCAACAAGCTCTCGACAGGCTGATGAAGAGCA
rJMSF047C13+ CACTCGACGTCGAGTCAGAGCGAATCGTCCAACAAGCTCTCGACAGGCTGATGAAGAGCA
                      ____________________________________________________________
consensus CACTCGACGTCGAGTCAGAGCGAATCGTCCAACAAGCTCTCGACAGGCTGATGAAGAGCA
 
. : . : . : . : . : . :
rJMSF052C15+ GAACATCTGTTGTTGTGGCACATAGATTATCTACCATAAAAAATGCTGACCAAATATGTG
rJMFF019D08+ GAACATCTGTTGTTGTGGCACATAGATTATCTACCATAAAAAATGCTGACCAAATATGTG
rJMSF047C13+ GAACATCTGTTGTTGTGGCACATAGATTATCTACCATAAAAAATGCTGACCAAATATGTG
                      ____________________________________________________________
consensus GAACATCTGTTGTTGTGGCACATAGATTATCTACCATAAAAAATGCTGACCAAATATGTG
 
. : . : . : . : . : . :
rJMSF052C15+ TGTTACAAGATGGGAAGATAATAGAGCAGGGGACTCATTCTACACTCATAGAGAACAGGG
rJMFF019D08+ TGTTACAAGATGGGAAGATAATAGAGCAGGGGACTCATTCTACACTCATAGAGAACAGGG
rJMSF047C13+ TGTTACAAGATGGGAAGATAATAGAGCAGGGGACTCATTCTACACTCATAGAGAACAGGG
                      ____________________________________________________________
consensus TGTTACAAGATGGGAAGATAATAGAGCAGGGGACTCATTCTACACTCATAGAGAACAGGG
 
. : . : . : . : . : . :
rJMSF052C15+ ATGGAGCATATTATAAGCTCATTAACTTACAGCAGCATCAACAACAATGTTAGAAGTTAT
rJMFF019D08+ ATGGAGCATATTATAAGCTCATTAACTTACAGCAGCATCAACAACAATGTTAGAAGTTAT
rJMSF047C13+ ATGGAGCATATTATAAGCTCATTAACTTACAGCAGCATCAACAACAATGTTAGAAGTTAT
                      ____________________________________________________________
consensus ATGGAGCATATTATAAGCTCATTAACTTACAGCAGCATCAACAACAATGTTAGAAGTTAT
 
. : . : . : . : . : . :
rJMSF052C15+ TTGGGAATTGGGATGCATAATTCAATGTATATCCTCTCCATAAAAATATAAT
rJMFF019D08+ TTGGGAATTGGGATGCATAATTCAATGTATATCCTCTCCATAAAAATATAAT
rJMSF047C13+ TTGGGAATTGGGATGCATAATTCAATGTATATCCTCTCCATAAAAATATAATAAATTTTG
                      ____________________________________________________________
consensus TTGGGAATTGGGATGCATAATTCAATGTATATCCTCTCCATAAAAATATAATAAATTTTG