Previous Contig 013689:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003K13Sequence406004538 (2)gb:AK117525_18155560.002Arabidopsis thaliana At5g02830 mRNA for unknown protein, complete cds, clone: RA719013689 (3)gb:AK117525_18155561e-30Arabidopsis thaliana At5g02830 mRNA for unknown protein, complete cds, clone: RA
JMSF032A01Sequence700004538 (2)gb:AK117525_18155561e-20Arabidopsis thaliana At5g02830 mRNA for unknown protein, complete cds, clone: RA731013689 (3)pir|T48304|T483042e-28hypothetical protein F9G14.140 - Arabidopsis thaliana>gb:ATF9G14_1551386 Arabido
JMSF046O22Sequence672013689 (3)gb:AK117525_18155561e-23Arabidopsis thaliana At5g02830 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF003K13+ TGTGAAGGTCTAATACAGAATCG
rJMSF032A01+ ATACAGAATCG
                      ____________________________________________________________
consensus TGTGAAGGTCTAATACAGAATCG
 
. : . : . : . : . : . :
rJMSF003K13+ CCATCAGAAAGAAGGGCAACTTACTTCCCAGAATAGGATTGATCTAGATCCTAAAAGTCT
rJMSF032A01+ CCATCAGAAAGNAGGGCAACTTACTTCCCAGAATAGGATTGATCTAGATCCTAAAAGTCT
rJMSF046O22+ TCCTAAAAGTCT
                      ____________________________________________________________
consensus CCATCAGAAAGAAGGGCAACTTACTTCCCAGAATAGGATTGATCTAGATCCTAAAAGTCT
 
. : . : . : . : . : . :
rJMSF003K13+ GCTTCTTGAGAAAGTTGCTGAACACTTGCAGAAGAGTAATGCTGGAAGCCTATCTATTGA
rJMSF032A01+ GCTTCTTGAGAAAGTTGCTGAACACTTGCAGAAGAGTAATGCTGGAAGCCTATCTATTGA
rJMSF046O22+ GCTTCTTGAGAAAGTTGCTGAACACTTGCAGAAGAGTAATGCTGGAAGCCTATCTATTGA
                      ____________________________________________________________
consensus GCTTCTTGAGAAAGTTGCTGAACACTTGCAGAAGAGTAATGCTGGAAGCCTATCTATTGA
 
. : . : . : . : . : . :
rJMSF003K13+ TCTTCAG-AAACTTTCTAAGGTTGAAGCTCGCACATTGGTTCTTGCAGTTCTGAGAATGA
rJMSF032A01+ TCTTCAG-AAACTTTCTAAGGTTGAAGCTCGCACATTGGTTCTTGCAGTTCTGAGAATGA
rJMSF046O22+ TCTTCAGAAAACTTTCTAAGGTTGAAGCTCGCACATTGGTTCTTGCAGTTCTGAGAATGA
                      ____________________________________________________________
consensus TCTTCAG-AAACTTTCTAAGGTTGAAGCTCGCACATTGGTTCTTGCAGTTCTGAGAATGA
 
. : . : . : . : . : . :
rJMSF003K13+ TGAAAGAGACATACAATCCAGGAGATTTAATTACAGATGATGTGCAGATCATATTAGGAG
rJMSF032A01+ TGAAAGAGACATACAATCCAGGAGATTTAATTACAGATGATGTGCAGATCATATTAGGAG
rJMSF046O22+ TGAAAGAGACATACAATCCAGGAGATTTAATTACAGATGATGTGCAGATCATATTAGGAG
                      ____________________________________________________________
consensus TGAAAGAGACATACAATCCAGGAGATTTAATTACAGATGATGTGCAGATCATATTAGGAG
 
. : . : . : . : . : . :
rJMSF003K13+ TAGATCAAGTAGGCACACCTGCGGCCAATCACGAAAGTGGAGTCAAGGAAACAATAATCG
rJMSF032A01+ TAGATCAAGTAGGCACACCTGCGGCCAATCACGAAAGTGGAGTCAAGGAAACAATAATCG
rJMSF046O22+ TAGATCAAGTAGGCACACCTGCGGCCAATCACGAAAGTGGAGTCAAGGAAACAATAATCG
                      ____________________________________________________________
consensus TAGATCAAGTAGGCACACCTGCGGCCAATCACGAAAGTGGAGTCAAGGAAACAATAATCG
 
. : . : . : . : . : . :
rJMSF003K13+ AACTCTTACAACATGATTTGCGTCTTGAGGTTGTTTCAACAGGATCCAAAACCGAAACCG
rJMSF032A01+ AACTCTTGCAACATGATTTGCGTCTTGAGGTTGTTTCAACAGGATCCAAAACCGAAACCG
rJMSF046O22+ AACTCTTGCAACATGATTTGCGTCTTGAGGTTGTTTCAACAGGATCCAAAACCGAAACCG
                      ____________________________________________________________
consensus AACTCTTGCAACATGATTTGCGTCTTGAGGTTGTTTCAACAGGATCCAAAACCGAAACCG
 
. : . : . : . : . : . :
rJMSF003K13+ ACAGAAATTATGGCGAGATAAACTCTGCAGATGAATCTTCAGACACAGAGGAGAACAGGG
rJMSF032A01+ ACAGAAATTATGGCGAGATAAACTCTGCAGATGAATCTTCAGACACAGAGGAGAACAGGG
rJMSF046O22+ ACAGAAATTATGGCGAGATAAACTCTGCAGATGAATCTTCAGACACAGAGGAGAACAGGG
                      ____________________________________________________________
consensus ACAGAAATTATGGCGAGATAAACTCTGCAGATGAATCTTCAGACACAGAGGAGAACAGGG
 
. : . : . : . : . : . :
rJMSF003K13+ AAAGCGGTGTTTTGCCATCACAATCGGATTTTCCTACAAGGAGACCTGCAGTTCTACAAA
rJMSF032A01+ AAAGCGGTGTTTTGCCATCACAATCGGATTTTCCTACAAGGAGACCTGCAGTTCTACAAA
rJMSF046O22+ AAAGCGGTGTTTTGCCATCACAATCGGATTTTCCTACAAGGAGACCTGCAGTTCTACAAA
                      ____________________________________________________________
consensus AAAGCGGTGTTTTGCCATCACAATCGGATTTTCCTACAAGGAGACCTGCAGTTCTACAAA
 
. : . : . : . : . : . :
rJMSF003K13+ AGTTGAAGATAACTAAGGAATCATTGGACTCTTGGCTACAGAGAATAATGGATGGTTCTG
rJMSF032A01+ AGTTGAAGATAACTAAGGAATCATTGGACTCTTGGCTACAGAGAATAATGGATGGTTCTG
rJMSF046O22+ AGTTGAAGATAACTAAGGAATCATTGGACTCTTGGCTACAGAGAATAATGGATGGTTCTG
                      ____________________________________________________________
consensus AGTTGAAGATAACTAAGGAATCATTGGACTCTTGGCTACAGAGAATAATGGATGGTTCTG
 
. : . : . : . : . : . :
rJMSF003K13+ AAAGGCAGTCCCCTACATCTGATATGTGAAAAACCATTCTGTAAGATTCTTTTTGCCCTT
rJMSF032A01+ AAAGGCAGTCCCCTACATCTGATATGTGAAAAACCATTCTGTAAGATTCTTTTTGCCCTT
rJMSF046O22+ AAAGGCAGTCCCCTACATCTGATATGTGAAAAACCATTCTGTAAGATTCTTTTTGCCCTT
                      ____________________________________________________________
consensus AAAGGCAGTCCCCTACATCTGATATGTGAAAAACCATTCTGTAAGATTCTTTTTGCCCTT
 
. : . : . : . : . : . :
rJMSF003K13+ TGATCTGTAAAGAGTTTCATTTGCTTCTCTTTTAGTAACAGAAATTATAGCACTGTAAAT
rJMSF032A01+ TGATCTGTAAAGAGTTTCATTTGCTTCTCTTTTAGTAACAGAAATTATAGCACTGTAAAT
rJMSF046O22+ TGATCTGTAAAGAGTTTCATTTGCTTCTCTTTTAGTAACAGAAATTATAGCACTGTAAAT
                      ____________________________________________________________
consensus TGATCTGTAAAGAGTTTCATTTGCTTCTCTTTTAGTAACAGAAATTATAGCACTGTAAAT
 
. : . : . : . : . : . :
rJMSF003K13+ TAGACCTGATGGTACTTCACTGAAATACTCTGCTCTG
rJMSF032A01+ TAGACCTGATGGTACTTCACTGAAATACTCTGCTCTGTATAATCATAAAATAAATAC
rJMSF046O22+ TAGACCTGATGGTACTTCACTGAAATACTCTGCTCTGTATAATCATAAAATAAATACTGT
                      ____________________________________________________________
consensus TAGACCTGATGGTACTTCACTGAAATACTCTGCTCTGTATAATCATAAAATAAATACTGT