Previous Contig 013688:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF046O21Sequence609013688 (2)586013688 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046O21- GGAAAGCCTTAGAACATCTCTGCTTCTCATTCTT
                      ____________________________________________________________
consensus GGAAAGCCTTAGAACATCTCTGCTTCTCATTCTT
 
. : . : . : . : . : . :
JMSF046O21- AACTTCCCGTTCTTCATTTCTCATCTCTGATTTATCTCTCTTCGATCTGATGGAAACCCT
                      ____________________________________________________________
consensus AACTTCCCGTTCTTCATTTCTCATCTCTGATTTATCTCTCTTCGATCTGATGGAAACCCT
 
. : . : . : . : . : . :
JMSF046O21- ACTAAGCATCGAAACAGAAGGATTGAAGGCTAACACTCAGATATGTATTCCTTTCTCTTT
                      ____________________________________________________________
consensus ACTAAGCATCGAAACAGAAGGATTGAAGGCTAACACTCAGATATGTATTCCTTTCTCTTT
 
. : . : . : . : . : . :
JMSF046O21- TTTTGTGTCAAATTTTTACAATTAACCTACCTAATTTTTGTTTAGATGTAGTATTATCTT
rJMSF046O21+ TTTACAATTAACCTACCTAATTTTTGNTTAGANGTAGTATTATCTT
                      ____________________________________________________________
consensus TTTTGTGTCAAATTTTTACAATTAACCTACCTAATTTTTGTTTAGATGTAGTATTATCTT
 
. : . : . : . : . : . :
JMSF046O21- ACATAATTTCTGGAAATGCTTAGCTTACAAATTACGATTTGGTTCTGCAAAAAATAAAAG
rJMSF046O21+ ACATAATTTCTGGAAATGCTTAGCTTACAAATTACGATTTGGTTNTGCAAAAAATAAAAG
                      ____________________________________________________________
consensus ACATAATTTCTGGAAATGCTTAGCTTACAAATTACGATTTGGTTCTGCAAAAAATAAAAG
 
. : . : . : . : . : . :
JMSF046O21- GCTTACACCCAGTTGTTTCGGTTTTGATTCTGGAATGTTTCGATTTTGTCTCATTTGCAA
rJMSF046O21+ GCTTACNCCCAGTTGTTTCGGNTTTGATTCTGGAATGNTTCGATTTTGTNTCNTTTGCAA
                      ____________________________________________________________
consensus GCTTACACCCAGTTGTTTCGGTTTTGATTCTGGAATGTTTCGATTTTGTCTCATTTGCAA
 
. : . : . : . : . : . :
JMSF046O21- TGTAAATCTTTCGAGTATTTTTCCCCTAATTTTATGTCTATAAAGCTGCCCTAATTTATG
rJMSF046O21+ NGNAAATCTTTCGNGNATTTTTCCCCTAATTTTANGTCTATAAAGNTGCCCTAATTTNTG
                      ____________________________________________________________
consensus TGTAAATCTTTCGAGTATTTTTCCCCTAATTTTATGTCTATAAAGCTGCCCTAATTTATG
 
. : . : . : . : . : . :
JMSF046O21- AAATCTAAAGCTTAAATTTACCGATTTTCATATTGGTTTTTACTGAGGTTTGTATTCACT
rJMSF046O21+ AAATNTAAAGNTTAAATTTACCGNTTTTCATATTGGNTTTTACTGNGGNTTGNATTCNCT
                      ____________________________________________________________
consensus AAATCTAAAGCTTAAATTTACCGATTTTCATATTGGTTTTTACTGAGGTTTGTATTCACT
 
. : . : . : . : . : . :
JMSF046O21- GCAAAAATACATTTTCCCAGACTATTAGAGGTTTTCTAATTAAGCTCTAAGTTAATTCTT
rJMSF046O21+ GCAAAAATACNTTTTCCCNGNCTNTTAGNGGNTTTNTAATTAAGCTNTAAGNTAATTCTT
                      ____________________________________________________________
consensus GCAAAAATACATTTTCCCAGACTATTAGAGGTTTTCTAATTAAGCTCTAAGTTAATTCTT
 
. : . : . : . : . : . :
JMSF046O21- TCATTTTTTTTTTTTTAAANCCATAAAAGCATTACAATTAACTTNGCTAACTTANATTTN
rJMSF046O21+ TCNTTTTTTTTTTTTTAAATCCATAAAAGCATTACAATTAACTTTGCTAACTTATATTTT
                      ____________________________________________________________
consensus TCATTTTTTTTTTTTTAAATCCATAAAAGCATTACAATTAACTTTGCTAACTTATATTTT
 
. : . : . : . : . : . :
JMSF046O21- ATTTTAGGAAAAANATTTGGNGGCATTAANGCTAC
rJMSF046O21+ ATTTTAGGAAAAATATTTGGAGGCATTAAAGCTACAATCAACACATTTAGAAGTAGTATG
                      ____________________________________________________________
consensus ATTTTAGGAAAAATATTTGGAGGCATTAAAGCTACAATCAACACATTTAGAAGTAGTATG
 
. : . : . : . : . : . :
rJMSF046O21+ AAATTGATCAAACTTGTTATTAAAGGTGTATGAAGACATAGCTCTCAAAGGAAACAACCA
                      ____________________________________________________________
consensus AAATTGATCAAACTTGTTATTAAAGGTGTATGAAGACATAGCTCTCAAAGGAAACAACCA
 
. : . : . : . : . : . :
rJMSF046O21+ TCACAGGAATCCTTACACACCCTACCAGCAAGTTTTCATCTTTACGCTTTAAATTAGGAT
                      ____________________________________________________________
consensus TCACAGGAATCCTTACACACCCTACCAGCAAGTTTTCATCTTTACGCTTTAAATTAGGAT