Previous Contig 013675:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002K15Sequence341004434 (2)730013675 (3)pir|H86319|H863195e-35hypothetical protein F26I16.4 - Arabidopsis thaliana>gb:AE005172_890822 Arabidop
JMSF019G16Sequence537019116753013675 (3)pir|H86319|H863191e-40hypothetical protein F26I16.4 - Arabidopsis thaliana>gb:AE005172_890822 Arabidop
JMSF046M14Sequence724013675 (3)pir|H86319|H863197e-34hypothetical protein F26I16.4 - Arabidopsis thaliana>gb:AE005172_890822 Arabidop

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF019G16+ CAGAAGGNTGAACTCTAGTCATGATGAAATCCACACGGATTATATTGCTTCGATCTG
rJMSF002K15+ TCTG
rJMSF046M14+ TCTG
                      ____________________________________________________________
consensus CAGAAGGNTGAACTCTAGTCATGATGAAATCCACACGGATTATATTGCTTCGATCTG
 
. : . : . : . : . : . :
rJMSF019G16+ TGAGAGCACAGACCCGGATCATAGATATGTTGCTGAAATTTTATTAGCTTCCGGCCTTCT
rJMSF002K15+ TGAGAGCACAGACCCGGATCATAGATATGTTGCTGAAATTTTATTAGCTTCCGGCCTTCT
rJMSF046M14+ TGAGAGCACAGACCCGGATCATAGATATGTTGCTGAAATTTTATTAGCTTCCGGCCTTCT
                      ____________________________________________________________
consensus TGAGAGCACAGACCCGGATCATAGATATGTTGCTGAAATTTTATTAGCTTCCGGCCTTCT
 
. : . : . : . : . : . :
rJMSF019G16+ CCTTGGAGACCTTGGTTCAAGCACAACAACGTATCAGTTCCATTCATCTGGCTACCCGAT
rJMSF002K15+ CCTTGGAGACCTTGGTTCAAGCACAACAACGTATCAGTTCCATTCATCTGGCTACCCGAT
rJMSF046M14+ CCTTGGAGACCTTGGTTCAAGCACAACAACGTATCAGTTCCATTCATCTGGCTACCCGAT
                      ____________________________________________________________
consensus CCTTGGAGACCTTGGTTCAAGCACAACAACGTATCAGTTCCATTCATCTGGCTACCCGAT
 
. : . : . : . : . : . :
rJMSF019G16+ CAATCCCGAGTTGTTTTCTGTTCTGGAACAAACCAAGGAAAGCACTTTAGGCAAGGAAGA
rJMSF002K15+ CAATCCCGAGTTGTTTTCTGTTCTGGAACAAACCAAGGAAAGCACTTTAGGCAAGGAAGA
rJMSF046M14+ CAATCCCGAGTTGTTTTCTGTTCTGGAACAAACCAAGGAAAGCACTTTAGGCAAGGAAGA
                      ____________________________________________________________
consensus CAATCCCGAGTTGTTTTCTGTTCTGGAACAAACCAAGGAAAGCACTTTAGGCAAGGAAGA
 
. : . : . : . : . : . :
rJMSF019G16+ ATGCGCCAAAGAAAACAGCAACAAGGCCAAGGAGAAGATCCATAGGAAGCTCATCTTTGA
rJMSF002K15+ ATGCGCCAAAGAAAACAGCAACAAGGCCAAGGAGAAGATCCATAGGAAGCTCATCTTTGA
rJMSF046M14+ ATGCGCCAAAGAAAACAGCAACAAGGCCAAGGAGAAGATCCATAGGAAGCTCATCTTTGA
                      ____________________________________________________________
consensus ATGCGCCAAAGAAAACAGCAACAAGGCCAAGGAGAAGATCCATAGGAAGCTCATCTTTGA
 
. : . : . : . : . : . :
rJMSF019G16+ TTTTGTCAATGAACTCCTTGCTGCAAAATTTGCTTTAGTAGGACCCTTTTCTGAGCCATG
rJMSF002K15+ TTTTGTCAATGAACTCCTTGCTGCAAAATTGGCTTTAGTAGGACCCTTTTCTGAGCCATG
rJMSF046M14+ TTTTGTCAATGAACTCCTTGCTGCAAAATTGGCTTTAGTAGGACCCTTTTCTGAGCCATG
                      ____________________________________________________________
consensus TTTTGTCAATGAACTCCTTGCTGCAAAATTGGCTTTAGTAGGACCCTTTTCTGAGCCATG
 
. : . : . : . : . : . :
rJMSF019G16+ GCTAAGGCCACGGGTGGCAGCCATGAAAGCCCCGAATTCACAAAAGCTTCTGAGAGAGTT
rJMSF002K15+ GCTAAGGCCACGGGTGGCAGCCATGAAAGCCCCGAATTCACAAAAGCTTCTGAGAGAGTT
rJMSF046M14+ GCTAAGGCCACGGGTGGCAGCCATGAAAGCCCCGAATTCACAAAAGCTTCTGAGAGAGTT
                      ____________________________________________________________
consensus GCTAAGGCCACGGGTGGCAGCCATGAAAGCCCCGAATTCACAAAAGCTTCTGAGAGAGTT
 
. : . : . : . : . : . :
rJMSF019G16+ ATGTGCAGAAATAGAACAGCTCCAGACTAAACCATCCAGATGCTCCTTGGACCAAGATGA
rJMSF002K15+ ATGTGCAGAAATAGAACAGCTCCAGACTAAACCATCCAGATGCTCCTTGGACCAAGATGA
rJMSF046M14+ ATGTGCAGAAATAGAACAGCTCCAGACTAAACCATCCAGATGCTCCTTGGACCAAGATGA
                      ____________________________________________________________
consensus ATGTGCAGAAATAGAACAGCTCCAGACTAAACCATCCAGATGCTCCTTGGACCAAGATGA
 
. : . : . : . : . : . :
rJMSF019G16+ AGATGATGAGCCAGAAAGTTGGTCAGATTTCGCGGCTGAAACTTCAAACATTGTTCTTTC
rJMSF002K15+ AGATGATGAGCCAGAAAGTTGGTCAGATTTCGCGGCTGAAACTTCAAACATTGTTCTTTC
rJMSF046M14+ AGATGATGAGCCAGAAAGTTGGTCAGATTTCGCGGCTGAAACTTCAAACATTGTTCTTTC
                      ____________________________________________________________
consensus AGATGATGAGCCAGAAAGTTGGTCAGATTTCGCGGCTGAAACTTCAAACATTGTTCTTTC
 
. : . : . : . : . : . :
rJMSF019G16+ TTTAGAGCGATTAGTCTTTAAAGATTTAGTTGATGAGATAGTAAGGGGTGATGGTAACAG
rJMSF002K15+ TTTAGAGCGATTAGTCTTTAAAGATTTAGTTGATGAGATAGTAAGGGGTGATGGTAACAG
rJMSF046M14+ TTTAGAGCGATTAGTCTTTAAAGATTTAGTTGATGAGATAGTAAGGGGTGATGGTAACAG
                      ____________________________________________________________
consensus TTTAGAGCGATTAGTCTTTAAAGATTTAGTTGATGAGATAGTAAGGGGTGATGGTAACAG
 
. : . : . : . : . : . :
rJMSF019G16+ TTTGAGAACCAAGCCAACCAGACAGAAGCAACTCTTCAAAAAATAGCTTGTTTCTAATTG
rJMSF002K15+ TTTGAGAACCAAGCCAACCAGACAGAAGCAACTCTTCAAAAAATAGCTTGTTTCTAATTG
rJMSF046M14+ TTTGAGAACCAAGCCAACCAGACAGAAGCAACTCTTCAAAAAATAGCTTGTTTCTAATTG
                      ____________________________________________________________
consensus TTTGAGAACCAAGCCAACCAGACAGAAGCAACTCTTCAAAAAATAGCTTGTTTCTAATTG
 
. : . : . : . : . : . :
rJMSF019G16+ CTTATTATTCCATTTTCTTGTATCTTTCTTTTTCATTACCTTTCTGGCTTTTGCTAAGAG
rJMSF002K15+ CTTATTATTCCATTTTCTTGTATCTTTCTTTTTCATTACCTTTCTGGCTTTTGCTAAGAG
rJMSF046M14+ CTTATTATTCCATTTTCTTGTATCTTTCTTTTTCATTACCTTTCTGGCTTTTGCTAAGAG
                      ____________________________________________________________
consensus CTTATTATTCCATTTTCTTGTATCTTTCTTTTTCATTACCTTTCTGGCTTTTGCTAAGAG
 
. : . : . : . : . : . :
rJMSF019G16+ TACAACATTCATGAATTCATATTGTAGTTCT
rJMSF002K15+ TACAACATTCATGAATTCATATTGTAGTTCTTGGATGGAAAGTAAAGGGGAAACCCCCT
rJMSF046M14+ TACAACATTCATGAATTCATATTGTAGTTCTTGGATGGAAAGTAAAGGGGAAACCCCCTG
                      ____________________________________________________________
consensus TACAACATTCATGAATTCATATTGTAGTTCTTGGATGGAAAGTAAAGGGGAAACCCCCTG