Previous Contig 013673:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003C07Sequence519013673 (12)gb:ZMPKCK2AL_17319873e-61Zea mays gene encoding protein kinase CK2 alpha subunit.698013673 (12)gb:BVU251895_16431736e-73Beta vulgaris mRNA for protein kinase 2 (cka2 gene).
JMSF013B21Sequence478013673 (12)gb:ZMPKCK2AL_17319873e-60Zea mays gene encoding protein kinase CK2 alpha subunit.744013673 (12)gb:BVU251895_16431732e-72Beta vulgaris mRNA for protein kinase 2 (cka2 gene).
JMSF016K01Sequence462013673 (12)gb:ZMPKCK2AL_17319876e-44Zea mays gene encoding protein kinase CK2 alpha subunit.745013673 (12)gb:BVU251895_1643173e-122Beta vulgaris mRNA for protein kinase 2 (cka2 gene).
JMSF023A09Sequence665013673 (12)gb:ZMPKCK2AL_17319874e-84Zea mays gene encoding protein kinase CK2 alpha subunit.753013673 (12)gb:BVU251895_16431732e-44Beta vulgaris mRNA for protein kinase 2 (cka2 gene).
JMSF029A14Sequence693013673 (12)gb:ZMPKCK2AL_17319875e-92Zea mays gene encoding protein kinase CK2 alpha subunit.755013673 (12)gb:BVU251895_16431739e-67Beta vulgaris mRNA for protein kinase 2 (cka2 gene).
JMSF046L23Sequence696007740 (2)gb:ZMPKCK2AL_17319871e-24Zea mays gene encoding protein kinase CK2 alpha subunit.709013673 (12)gb:BVU251895_16431732e-53Beta vulgaris mRNA for protein kinase 2 (cka2 gene).
JMSF053O11Sequence662007740 (2)gb:ZMPKCK2AL_17319871e-24Zea mays gene encoding protein kinase CK2 alpha subunit.880013673 (12)gb:BVU251895_1643173e-112Beta vulgaris mRNA for protein kinase 2 (cka2 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF023A09- GATAACATAACAGGCGTG
JMSF016K01- GTG
JMSF029A14- GTG
                      ____________________________________________________________
consensus GATAACATAACAGGCGTG
 
. : . : . : . : . : . :
JMSF023A09- GGAACGTGGGGTGGAGAGGGACAACATATAANAAGGCTGGCTGGCTGGCTGGCGGGCGAG
JMFF003C07- GACAACATATAAAAAGGCTGGCTGGCTGGCTGGCGGGCGAG
JMSF016K01- GGAACGTGGGGTGGAGAGGGACAACATATAAAAAGGCTGGCTGGCTGGCTGGCGGGCGAG
JMSF029A14- GGAACGTGGGGTGGAGAGGGACAACATATAAAAAGGCTGGCTGGCTGGCTGGCGGGCGAG
                      ____________________________________________________________
consensus GGAACGTGGGGTGGAGAGGGACAACATATAAAAAGGCTGGCTGGCTGGCTGGCGGGCGAG
 
. : . : . : . : . : . :
JMSF023A09- AGAGGAACTATAGCTTCAGATCCTTCGCCTCATCGGCGAGCAATCGGGTATGTCTCAAGC
JMSF013B21- GAGGAACTATAGCTTCAGATCCTTCGCCTCATCGGCGAGCAATCGGGTATGTCTCAAGC
JMFF003C07- AGAGGAACTATAGCTTCAGATCCTTCGCCTCATCGGCGAGCAATCGGGTATGTCTCAAGC
JMSF016K01- AGAGGAACTATAGCTTCAGATCCTTCGCCTCATCGGCGAGCAATCGGGTATGTCTCAAGC
JMSF029A14- AGAGGAACTATAGCTTCAGATCCTTCGCCTCATCGGCGAGCAATCGGGTATGTCTCAAGC
                      ____________________________________________________________
consensus AGAGGAACTATAGCTTCAGATCCTTCGCCTCATCGGCGAGCAATCGGGTATGTCTCAAGC
 
. : . : . : . : . : . :
JMSF023A09- ACGAGTCTACGCTGACGTCAACGTTCACCGTCCTAAGGATTATTGGGACTATGAAGCTCT
JMSF013B21- ACGAGTCTACGCTGACGTCAACGTTCACCGTCCTAAGGATTATTGGGACTATGAAGCTCT
JMFF003C07- ACGAGTCTACGCTGACGTCAACGTTCACCGTCCTAAGGATTATTGGGACTATGAAGCTCT
JMSF016K01- ACGAGTCTACGCTGACGTCAACGTTCACCGTCCTAAGGATTATTGGGACTATGAAGCTCT
JMSF029A14- ACGAGTCTACGCTGACGTCAACGTTCACCGTCCTAAGGATTATTGGGACTATGAAGCTCT
                      ____________________________________________________________
consensus ACGAGTCTACGCTGACGTCAACGTTCACCGTCCTAAGGATTATTGGGACTATGAAGCTCT
 
. : . : . : . : . : . :
JMSF023A09- TACCGTTCAATGGGGTGATCAGGATGACTATGAAGTTGTTCGGAAAGTGGGAAGAGGAAA
JMSF013B21- TACCGTTCAATGGGGTGATCAGGATGACTATGAAGTTGTTCGGAAAGTGGGAAGAGGAAA
JMFF003C07- TACCGTTCAATGGGGTGATCAGGATGACTATGAAGTTGTTCGGAAAGTGGGAAGAGGAAA
JMSF016K01- TACCGTTCAATGGGGTGATCAGGATGACTATGAAGTTGTTCGGAAAGTGGGAAGAGGAAA
JMSF029A14- TACCGTTCAATGGGGTGATCAGGATGACTATGAAGTTGTTCGGAAAGTGGGAAGAGGAAA
                      ____________________________________________________________
consensus TACCGTTCAATGGGGTGATCAGGATGACTATGAAGTTGTTCGGAAAGTGGGAAGAGGAAA
 
. : . : . : . : . : . :
JMSF023A09- ATACAGTGAGGTCTTTGAAGGAGTAAATATCACCAACAATGAGAAGTGCATCATCAAAAT
JMSF013B21- ATACAGTGAGGTCTTTGAAGGAGTAAATATCACCAACAATGAGAAGTGCATCATCAAAAT
JMFF003C07- ATACAGTGAGGTCTTTGAAGGAGTAAATATCACCAACAATGAGAAGTGCATCATCAAAAT
JMSF016K01- ATACAGTGAGGTCTTTGAAGGAGTAAATATCACCAACAATGAGAAGTGCATCATCAAAAT
JMSF029A14- ATACAGTGAGGTCTTTGAAGGAGTAAATATCACCAACAATGAGAAGTGCATCATCAAAAT
                      ____________________________________________________________
consensus ATACAGTGAGGTCTTTGAAGGAGTAAATATCACCAACAATGAGAAGTGCATCATCAAAAT
 
. : . : . : . : . : . :
JMSF023A09- ACTTAAACCCGTGAAAAAGAAGAAGATAAAAAGGGAAATAAAAATACTTCAGAATCTTTG
JMSF013B21- ACTTAAACCCGTGAAAAAGAAGAAGATAAAAAGGGAAATAAAAATACTTCAGAATCTTTG
JMFF003C07- ACTTAAACCCGTGAAAAAGAAGAAGATAAAAAGGGAAATAAAAATACTTCAGAATCTTTG
JMSF016K01- ACTTAAACCCGTGAAAAAGAAGAAGATAAAAAGGGAAATAAAAATACTTCAGAATCTTTG
JMSF029A14- ACTTAAACCCGTGAAAAAGAAGAAGATAAAAAGGGAAATAAAAATACTTCAGAATCTTTG
                      ____________________________________________________________
consensus ACTTAAACCCGTGAAAAAGAAGAAGATAAAAAGGGAAATAAAAATACTTCAGAATCTTTG
 
. : . : . : . : . : . :
JMSF023A09- TGGAGGCCCAAATATTGTAAAACTCTATGATATTGTCAGAGACCAGCACTCAAAAACTCC
JMSF013B21- TGGAGGCCCAAATATTGTAAAACTCTATTATATTGTCAGAGACCAGCACTCAAAAACTCC
JMFF003C07- TGGAGGCCCAAATATTGTAAAACTCTATGATATTGTCAGAGACCAGCACTCAAAAACTCC
JMSF016K01- TGGAGGCCCAAATATTGTAAAACTCTATGATATTGTCAGAGACCAGCACTCAAAAACTCC
JMSF029A14- TGGAGGCCCAAATATTGTAAAACTCTATGATATTGTCAGAGACCAGCACTCAAAAACTCC
                      ____________________________________________________________
consensus TGGAGGCCCAAATATTGTAAAACTCTATGATATTGTCAGAGACCAGCACTCAAAAACTCC
 
. : . : . : . : . : . :
JMSF023A09- CAGTTTGATTTTTGAATATGTGAACAGTACAGATTTCAAAGTCTTGTATCCGACACTGAC
JMSF013B21- CAGTTTGATTTTTGAATATGTGAACAGTACAGATTTCAAAGTCTTGTATCCGACACTGAC
JMFF003C07- CAGTTTGATTTTTGAATATGTGAACAGTACAGATTTCAAAGTCTTGTATCCGACACTGAC
JMSF016K01- CAGTTTGATTTTTGAATATGTGAACAGTACAGATTTCA
JMSF029A14- CAGTTTGATTTTTGAATATGTGAACAGTACAGATTTCAAAGTCTTGTATCCGACACTGAC
rJMSF016K01+ TATCCGACACTGAC
                      ____________________________________________________________
consensus CAGTTTGATTTTTGAATATGTGAACAGTACAGATTTCAAAGTCTTGTATCCGACACTGAC
 
. : . : . : . : . : . :
JMSF023A09- TGATTATGACATCCGCTACTACATTTATGAGCTTCTCAAGGCACTGGATTATTGCCATTC
JMSF013B21- TGATTATGACATCCGCTACTACATTTATGAGCTTCTCAAGGCACTGGATTATTGCCAT
JMFF003C07- TGATTATGACATCCGCTACTACATTTATGAGCTTCTCAAGGCACTGGATTATTGCCAT
JMSF029A14- TGATTATGACATCCGCTACTACATTTATGAGCTTCTCAAGGCACTGGATTATTGCCATTC
rJMSF016K01+ TGATTATGACATCCGCTACTACATTTATGAGCTTCTCAAGGCACTGGATTATTGCCATTC
rJMSF053O11+ AGGCACTGGATTATTGCCATTC
                      ____________________________________________________________
consensus TGATTATGACATCCGCTACTACATTTATGAGCTTCTCAAGGCACTGGATTATTGCCATTC
 
. : . : . : . : . : . :
JMSF023A09- ACAAGGAATAATGCACAGAGATGTTAAACCTCACAATGTCATGATTGATCATGAATTAAG
JMSF029A14- ACAAGGAATAATGCACAGAGATGTTAAACCTCACAATGTCATGATTGATCATGAATTAAG
rJMSF016K01+ ACAAGGAATAATGCACAGAGATGTTAAACCTCACAATGTCATGATTGATCATGAATTAAG
rJMSF053O11+ ACAAGGAATAATGCACAGAGATGTTAAACCTCACAATGTCATGATTGATCATGAATTAAG
                      ____________________________________________________________
consensus ACAAGGAATAATGCACAGAGATGTTAAACCTCACAATGTCATGATTGATCATGAATTAAG
 
. : . : . : . : . : . :
JMSF023A09- AAAACTTCGTTTGATTGATTGGGGTCTTGCTGAGTTTTATCATCCTG
JMSF029A14- AAAACTTCGTTTGATTGATTGGGGTCTTGCTGAGTTTTATCATCCTGGTAAAGAATACAA
rJMSF016K01+ AAAACTTCGTTTGATTGATTGGGGTCTTGCTGAGTTTTATCATCCTGGTAAAGAATACAA
rJMSF053O11+ AAAACTTCGTTTGATTGATTGGGGTCTTGCTGAGTTTTATCATCCTGGTAAAGAATACAA
                      ____________________________________________________________
consensus AAAACTTCGTTTGATTGATTGGGGTCTTGCTGAGTTTTATCATCCTGGTAAAGAATACAA
 
. : . : . : . : . : . :
JMSF029A14- TGTCAGAGTAGCCTCAAGGTACTTT
rJMSF016K01+ TGTCAGAGTAGCCTCAAGGTACTTTAAGGGGCCTGAACTACTCGTGGATTTGCAAGACTA
rJMSF053O11+ TGTCAGAGTAGCCTCAAGGTACTTTAAGGGGCCTGAACTACTCGTGGATTTGCAAGACTA
rJMFF003C07+ GTGGATTTGCAAGACTA
rJMSF013B21+ GTGGATTTGCAAGACTA
                      ____________________________________________________________
consensus TGTCAGAGTAGCCTCAAGGTACTTTAAGGGGCCTGAACTACTCGTGGATTTGCAAGACTA
 
. : . : . : . : . : . :
rJMSF016K01+ TGATTATTCCTTGGACATGTGGAGTCTTGGCTGCATGTTCGCAGGAATGATCTTTAGGAA
rJMSF053O11+ TGATTATTCCTTGGACATGTGGAGTCTTGGCTGCATGTTCGCAGGAATGATCTTTAGGAA
rJMFF003C07+ TGATTATTCCTTGGACATGTGGAGTCTTGGCTGCATGTTCGCAGGAATGATCTTTAGGAA
rJMSF013B21+ TGATTATTCCTNGGACATGTGGAGTCTNGGCTGCATGTTCGCAGGAATGATCTTTAGGAA
rJMSF029A14+ GGACATGTGGAGTCTNGGCTGCATGTTCGCAGGAATGATCTTTAGGAA
                      ____________________________________________________________
consensus TGATTATTCCTTGGACATGTGGAGTCTTGGCTGCATGTTCGCAGGAATGATCTTTAGGAA
 
. : . : . : . : . : . :
rJMSF016K01+ AGAGCCATTCTTCTATGGCCATGACAACCATGATCAACTTGTTAAAATTGCAAAGGTTCT
rJMSF053O11+ AGAGCCATTCTTCTATGGCCATGACAACCATGATCAACTTGTTAAAATTGCAAAGGTTCT
rJMFF003C07+ AGAGCCATTCTTCTATGGCCATGACAACCATGATCAACTTGTTAAAATTGCAAAGGTTCT
rJMSF023A09+ AGGTTCT
rJMSF013B21+ AGAGCCATTCTTCTATGGCCATGACAACCATGATCAACTTGTTAAAATTGCAAAGGTTCT
rJMSF029A14+ AGAGCCATTCTTCTATGGCCATGACAACCATGATCAACTTGTTAAAATTGCAAAGGTTCT
rJMSF046L23+ TATGGCCATGACAACCATGATCAACTTGTTAAAATTGCAAAGGTTCT
                      ____________________________________________________________
consensus AGAGCCATTCTTCTATGGCCATGACAACCATGATCAACTTGTTAAAATTGCAAAGGTTCT
 
. : . : . : . : . : . :
rJMSF016K01+ TGGCACAGACGAGTTAAATGCATATCTCAACAAATATCATCTGGAGCTTGATCCTCAACT
rJMSF053O11+ TGGCACAGACGAGTTAAATGCATATCTCAACAAATATCATCTGGAGCTTGATCCTCAACT
rJMFF003C07+ TGGCACAGACGAGTTAAATGCATATCTCAACAAATATCATCTGGAGCTTGATCCTCAACT
rJMSF023A09+ TGGCACAGACGAGTTAAATGCATATCTCAACAAATATCATCTGGAGCTTGATCCTCAACT
rJMSF013B21+ TGGCACAGACGAGTTAAATGCATATCTCAACAAATATCATCTGGAGCTTGATCCTCAACT
rJMSF029A14+ TGGCACAGACGAGTTAAATGCATATCTCAACAAATATCATCTGGAGCTTGATCCTCAACT
rJMSF046L23+ TGGCACAGACGAGTTAAATGCATATCTCAACAAATATCATCTGGAGCTTGATCCTCAACT
                      ____________________________________________________________
consensus TGGCACAGACGAGTTAAATGCATATCTCAACAAATATCATCTGGAGCTTGATCCTCAACT
 
. : . : . : . : . : . :
rJMSF016K01+ TGATGCTCTGGTTGGAAGGCACAGCAGGAAACCTTGGTCCCGATTTATTAATTCAGACAA
rJMSF053O11+ TGATGCTCTGGTTGGAAGGCACAGCAGGAAACCTTGGTCCCGATTTATTAATTCAGACAA
rJMFF003C07+ TGATGCTCTGGTTGGAAGGCACAGCAGGAAACCTTGGTCCCGATTTATTAATTCAGACAA
rJMSF023A09+ TGATGCTCTGGTTGGAAGGCACAGCAGGAAACCTTGGTCCCGATTTATTAATTCAGACAA
rJMSF013B21+ TGATGCTCTGGTTGGAAGGCACAGCAGGAAACCTTGGTCCCGATTTATTAATTCAGACAA
rJMSF029A14+ TGATGCTCTGGTTGGAAGGCACAGCAGGAAACCTTGGTCCCGATTTATTAATTCAGACAA
rJMSF046L23+ TGATGCTCTGGTTGGAAGGCACAGCAGGAAACCTTGGTCCCGATTTATTAATTCAGACAA
                      ____________________________________________________________
consensus TGATGCTCTGGTTGGAAGGCACAGCAGGAAACCTTGGTCCCGATTTATTAATTCAGACAA
 
. : . : . : . : . : . :
rJMSF016K01+ CCAGCATTTAGTTTCTCCAGAGGCAATTGATTTCCTTGATAAGCTCCTTCGTTATGATCA
rJMSF053O11+ CCAGCATTTAGTTTCTCCAGAGGCAATTGATTTCCTTGATAAGCTCCTTCGTTATGATCA
rJMFF003C07+ CCAGCATTTAGTTTCTCCAGAGGCAATTGATTTCCTTGATAAGCTCCTTCGTTATGATCA
rJMSF023A09+ CCAGCATTTAGTTTCTCCAGAGGCAATTGATTTCCTTGATAAGCTCCTTCGTTATGATCA
rJMSF013B21+ CCAGCATTTAGTTTCTCCAGAGGCAATTGATTTCCTTGATAAGCTCCTTCGTTATGATCA
rJMSF029A14+ CCAGCATTTAGTTTCTCCAGAGGCAATTGATTTCCTTGATAAGCTCCTTCGTTATGATCA
rJMSF046L23+ CCAGCATTTAGTTTCTCCAGAGGCAATTGATTTCCTTGATAAGCTCCTTCGTTATGATCA
                      ____________________________________________________________
consensus CCAGCATTTAGTTTCTCCAGAGGCAATTGATTTCCTTGATAAGCTCCTTCGTTATGATCA
 
. : . : . : . : . : . :
rJMSF016K01+ TCAAGACAGACTTACAGCTAAAGAAGCTATGGCACATCCATACTTCTTCCAAGTGAGGGC
rJMSF053O11+ TCAAGACAGACTTACAGCTAAAGAAGCTATGGCACATCCATACTTCTTCCAAGTGAGGGC
rJMFF003C07+ TCAAGACAGACTTACAGCTAAAGAAGCTATGGCACATCCATACTTCTTCCAAGTGAGGGC
rJMSF023A09+ TCAAGACAGACTTACAGCTAAAGAAGCTATGGCACATCCATACTTCTTCCAAGTGAGGGC
rJMSF013B21+ TCAAGACAGACTTACAGCTAAAGAAGCTATGGCACATCCATACTTCTTCCAAGTGAGGGC
rJMSF029A14+ TCAAGACAGACTTACAGCTAAAGAAGCTATGGCACATCCATACTTCTTCCAAGTGAGGGC
rJMSF046L23+ TCAAGACAGACTTACAGCTAAAGAAGCTATGGCACATCCATACTTCTTCCAAGTGAGGGC
                      ____________________________________________________________
consensus TCAAGACAGACTTACAGCTAAAGAAGCTATGGCACATCCATACTTCTTCCAAGTGAGGGC
 
. : . : . : . : . : . :
rJMSF016K01+ AGCTGAAAACAGCAGGGTGCGTACACAGTAGCGATGGCCCCCTCTATATACATCATGATT
rJMSF053O11+ AGCTGAAAACAGCAGGGTGCGTACACAGTAGCGATGGCCCCCTCTATATACATCATGATT
rJMFF003C07+ AGCTGAAAACAGCAGGGTGCGTACACAGTAGCGATGGCCCCCTCTATATACATCATGATT
rJMSF023A09+ AGCTGAAAACAGCAGGGTGCGTACACAGTAGCGATGGCCCCCTCTATATACATCATGATT
rJMSF013B21+ AGCTGAAAACAGCAGGGTGCGTACACAGTAGCGATGGCCCCCTCTATATACATCATGATT
rJMSF029A14+ AGCTGAAAACAGCAGGGTGCGTACACAGTAGCGATGGCCCCCTCTATATACATCATGATT
rJMSF046L23+ AGCTGAAAACAGCAGGGTGCGTACACAGTAGCGATGGCCCCCTCTATATACATCATGATT
                      ____________________________________________________________
consensus AGCTGAAAACAGCAGGGTGCGTACACAGTAGCGATGGCCCCCTCTATATACATCATGATT
 
. : . : . : . : . : . :
rJMSF016K01+ ATTTGTAATGGAGTTGCAAAGCGCGTGTGTACATTGCTGTCAAAATGTCTTGATCACACA
rJMSF053O11+ ATTTGTAATGGAGTTGCAAAGCGCGTGTGTACATTGCTGTCAAAATGTCTTGATCACACA
rJMFF003C07+ ATTTGTAATGGAGTTGCAAAGCGCGTGTGTACATTGCTGTCAAAATGTCTTGATCACACA
rJMSF023A09+ ATTTGTAATGGAGTTGCAAAGCGCGTGTGTACATTGCTGTCAAAATGTCTTGATCACACA
rJMSF013B21+ ATTTGTAATGGAGTTGCAAAGCGCGTGTGTACATTGCTGTCAAAATGTCTTGATCACACA
rJMSF029A14+ ATTTGTAATGGAGTTGCAAAGCGCGTGTGTACATTGCTGTCAAAATGTCTTGATCACACA
rJMSF046L23+ ATTTGTAATGGAGTTGCAAAGCGCGTGTGTACATTGCTGTCAAAATGTCTTGATCACACA
                      ____________________________________________________________
consensus ATTTGTAATGGAGTTGCAAAGCGCGTGTGTACATTGCTGTCAAAATGTCTTGATCACACA
 
. : . : . : . : . : . :
rJMSF016K01+ C-TGGAACGACT
rJMSF053O11+ CTTGGAACGACTTTTATGTAGTGATGAAAGTGCATGGCTCATTTATTTCCCCCACTTGAG
rJMFF003C07+ CTTGGAACGACTTTTATGTAGTGATGAAAGTGCATGGCTCATTTATTTCCCCCACTTGAG
rJMSF023A09+ CTTGGAACGACTTTTATGTAGTGATGAAAGTGCATGGCTCATTTATTTCCCCCACTTGAG
rJMSF013B21+ CTTGGAACGACTTTTATGTAGTGATGAAAGTGCATGGCTCATTTATTTCCCCCACTTGAG
rJMSF029A14+ CTTGGAACGACTTTTATGTAGTGATGAAAGTGCATGGCTCATTTATTTCCCCCACTTGAG
rJMSF046L23+ CTTGGAACGACTTTTATGTAGTGATGAAAGTGCATGGCTCATTTATTTCCCCCACTTGAG
                      ____________________________________________________________
consensus CTTGGAACGACTTTTATGTAGTGATGAAAGTGCATGGCTCATTTATTTCCCCCACTTGAG
 
. : . : . : . : . : . :
rJMSF053O11+ CAGATTGATGAAGCTAACTTTAATTTTTACGTTAGCATTCTTCAACTCCCATATCCATTT
rJMFF003C07+ CAGATTGATGAAGCTAACTTTAATTTTTACGTTAGCATTCTTCAACTCCCATATCCATTT
rJMSF023A09+ CAGATTGATGAAGCTAACTTTAATTTTTACGTTAGCATTCTTCAACTCCCATATCCATTT
rJMSF013B21+ CAGATTGATGAAGCTAACTTTAATTTTTACGTTAGCATTCTTCAACTCCCATATCCATTT
rJMSF029A14+ CAGATTGATGAAGCTAACTTTAATTTTTACGTTAGCATTCTTCAACTCCCATATCCATTT
rJMSF046L23+ CAGATTGATGAAGCTAACTTTAATTTTTACGTTAGCATTCTTCAACTCCCATATCCATTT
                      ____________________________________________________________
consensus CAGATTGATGAAGCTAACTTTAATTTTTACGTTAGCATTCTTCAACTCCCATATCCATTT
 
. : . : . : . : . : . :
rJMSF053O11+ GTGGGCTGTATATTCTATCGTAAATGTTGTGAA-CTGTGAATGTCATGTC
rJMFF003C07+ GTGGGCTGTATATTCTATCGTAAATGTTGTGAA-CTGTGAATGTCATGTCAGCTCGCATG
rJMSF023A09+ GTGGGCTGTATATTCTATCGTAAATGTTGTGAACCTGTGAATGTCANGTCAGCTCGCATG
rJMSF013B21+ GTGGGCTGTATATTCTATCGTAAATGTTGTGAA-CTGTGAATGTCATGTCAGCTCGCATG
rJMSF029A14+ GTGGGCTGTATATTCTATCGTAAATGTTGTGAA-CTGTGAATGTCATGTCAGCTCGCATG
rJMSF046L23+ GTGGGCTGTATATTCTATCGTAAATGTTGTGAA-CTGTGAATGTCATGTCAGCTCGCATG
                      ____________________________________________________________
consensus GTGGGCTGTATATTCTATCGTAAATGTTGTGAA-CTGTGAATGTCATGTCAGCTCGCATG
 
. : . : . : . : . : . :
rJMFF003C07+ GCCTTTTCAGTACTACTACACA
rJMSF023A09+ GCCTNTTCAGTACTACTACACATAAAAT
rJMSF013B21+ GCCTTTTCAGTACTACTACACATAAAAT--CTTGTTGGCATCTCATCAGTGTACTTGTTT
rJMSF029A14+ GCCTTTTCAGTACTACTACACATAAAATAGCTTGTTGGCATCTCATCAGTGTACTTGTTT
rJMSF046L23+ GCCTTTTCAGTACTACTACACATAAAATAGCTTGTTGGCATCTCATCAGTGTACTTGTTT
                      ____________________________________________________________
consensus GCCTTTTCAGTACTACTACACATAAAATAGCTTGTTGGCATCTCATCAGTGTACTTGTTT
 
. : . : . : . : . : . :
rJMSF013B21+ GGGAATGCCT
rJMSF029A14+ GGGAATGCCTTGTTTACATTCAAGCTGCATGCCATT
rJMSF046L23+ GGGAATGCCTTGTTTACATTCAAGCTGCATGCCATTTGTTTCAGTGTGTAACATCGTACT
                      ____________________________________________________________
consensus GGGAATGCCTTGTTTACATTCAAGCTGCATGCCATTTGTTTCAGTGTGTAACATCGTACT