Previous Contig 013671:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF030N15Sequence636001565 (143)gb:AB012638_15118842e-94Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b222013671 (3)
JMSF046K23Sequence752013671 (3)gb:AF161711_17734156e-71Pimpinella brachycarpa myb-related transcription factor mRNA, complete cds.651013671 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046K23- GTGGCATGCTCATCCATCATT
                      ____________________________________________________________
consensus GTGGCATGCTCATCCATCATT
 
. : . : . : . : . : . :
JMSF046K23- CATTCTCTCATATATATAAAGGAAGGTGGTGATCGAGTGGGCCTCTGGGACAGATCCGTA
                      ____________________________________________________________
consensus CATTCTCTCATATATATAAAGGAAGGTGGTGATCGAGTGGGCCTCTGGGACAGATCCGTA
 
. : . : . : . : . : . :
JMSF046K23- TCTGAGAAAAGTAATAATAATAATAATTCTTTTCTTCTTCTTCTTCTTCATTTGGCTCCA
                      ____________________________________________________________
consensus TCTGAGAAAAGTAATAATAATAATAATTCTTTTCTTCTTCTTCTTCTTCATTTGGCTCCA
 
. : . : . : . : . : . :
JMSF046K23- AGGATTAGCTAGGTAGAGCATTGCAGCAAGATTGCTTAATTGTTATGGGCAGGCAACCTT
                      ____________________________________________________________
consensus AGGATTAGCTAGGTAGAGCATTGCAGCAAGATTGCTTAATTGTTATGGGCAGGCAACCTT
 
. : . : . : . : . : . :
JMSF046K23- GCTGTGATAAGTTGGGTGTGAAGAAAGGGCCGTGGACTGCTGAGGAAGATAGGAAGCTCA
                      ____________________________________________________________
consensus GCTGTGATAAGTTGGGTGTGAAGAAAGGGCCGTGGACTGCTGAGGAAGATAGGAAGCTCA
 
. : . : . : . : . : . :
JMSF046K23- TCTCTTTCATCCTCACCAATGGCCACTGCTGCTGGCGCGCCGTCCCTAAGCTCGCCGGCC
                      ____________________________________________________________
consensus TCTCTTTCATCCTCACCAATGGCCACTGCTGCTGGCGCGCCGTCCCTAAGCTCGCCGGCC
 
. : . : . : . : . : . :
JMSF046K23- TCCGCCGCTGCGGCAAGAGCTGCCGCCTCCGCTGGACTAACTACCTCCGCCCCGACTTGA
                      ____________________________________________________________
consensus TCCGCCGCTGCGGCAAGAGCTGCCGCCTCCGCTGGACTAACTACCTCCGCCCCGACTTGA
 
. : . : . : . : . : . :
JMSF046K23- AGCGCGGCCTTCTTACTCAAGAGGAAGAGAAGCTGGTCATTGATCTCCATGCACGCCTCG
                      ____________________________________________________________
consensus AGCGCGGCCTTCTTACTCAAGAGGAAGAGAAGCTGGTCATTGATCTCCATGCACGCCTCG
 
. : . : . : . : . : . :
JMSF046K23- GCAACAGGTGGGCGAAAATTGCAGCAAGATTACCTGGGAGAACAGACAATGAGATCAAGA
                      ____________________________________________________________
consensus GCAACAGGTGGGCGAAAATTGCAGCAAGATTACCTGGGAGAACAGACAATGAGATCAAGA
 
. : . : . : . : . : . :
JMSF046K23- ACCATTGGAACACTCATATAAAGAAGAAGCTTATAAAGATGGGAGTAGATCCACTGACAC
                      ____________________________________________________________
consensus ACCATTGGAACACTCATATAAAGAAGAAGCTTATAAAGATGGGAGTAGATCCACTGACAC
 
. : . : . : . : . : . :
JMSF046K23- ATGAGCCATTACAGAAAGATGATGATGAAGAAATGCTGCCACCATCTTCATTATCACTAC
                      ____________________________________________________________
consensus ATGAGCCATTACAGAAAGATGATGATGAAGAAATGCTGCCACCATCTTCATTATCACTAC
 
. : . : . : . : . : . :
JMSF046K23- ATTCTGGTGATGATCAAAAGCTTAAACCTGCAGAGAATGATGATGATCTGGAAGAAGAGC
rJMSF046K23+ GATGATCAAAAGCTTAAACCTGCAGAGAATGATGATGATNTGGAAGAAGAGC
                      ____________________________________________________________
consensus ATTCTGGTGATGATCAAAAGCTTAAACCTGCAGAGAATGATGATGATCTGGAAGAAGAGC
 
. : . : . : . : . : . :
JMSF046K23- TACCAAAAATGGAAGAACATCAACAGTGC-TCTAGCAAGGAAGCCATGTTTGCAGCAGGT
rJMSF046K23+ TACCAAAAATGGAAGAACATCAACAGTGCTTCTAGCAAGGAAGCCATGTTTGCAGCAGGT
                      ____________________________________________________________
consensus TACCAAAAATGGAAGAACATCAACAGTGCTTCTAGCAAGGAAGCCATGTTTGCAGCAGGT
 
. : . : . : . : . : . :
JMSF046K23- CCACAGGTGGAA
rJMSF046K23+ CCNCAGGTGGAAGAAGCTGATTATGACCCATGGATGAGCCAGTTATTGTCAGACACNTTT
                      ____________________________________________________________
consensus CCACAGGTGGAAGAAGCTGATTATGACCCATGGATGAGCCAGTTATTGTCAGACACNTTT
 
. : . : . : . : . : . :
rJMSF046K23+ TTCAACGATNTGTCATGGAGTTTTGGAGGAGATGAATGCNGTGACTTTGCCANGTCATCA
                      ____________________________________________________________
consensus TTCAACGATNTGTCATGGAGTTTTGGAGGAGATGAATGCNGTGACTTTGCCANGTCATCA
 
. : . : . : . : . : . :
rJMSF046K23+ TCTTCTCATGGAAGCTCATCAGAATGGCTCNTGGATTTGCAAGATTTTGGNGAAGATCAA
                      ____________________________________________________________
consensus TCTTCTCATGGAAGCTCATCAGAATGGCTCNTGGATTTGCAAGATTTTGGNGAAGATCAA
 
. : . : . : . : . : . :
rJMSF046K23+ AGCTGGGCNTTATTGCCTGGTAATCAGCCTCCCAAGAACATGGACNTGGNGATTCNCNCC
                      ____________________________________________________________
consensus AGCTGGGCNTTATTGCCTGGTAATCAGCCTCCCAAGAACATGGACNTGGNGATTCNCNCC
 
. : . : . : . : . : . :
rJMSF046K23+ CNGGATATAATATAAGCTGGAAGTTNTGNTGATATATNTGATGGACATGTGATCATCNCG
                      ____________________________________________________________
consensus CNGGATATAATATAAGCTGGAAGTTNTGNTGATATATNTGATGGACATGTGATCATCNCG
 
. : . : . : . : . : . :
rJMSF030N15+ TTAAAGTATNAACAATTTTNCCNGTCCTGCNAACNTGNAGAATAAGAATACNANN
rJMSF046K23+ NGATNTTAATGTATAAACAATTTTACCNGTCCTGCAAACTTGAAGAATAAGAATACNATA
                      ____________________________________________________________
consensus NGATNTTAATGTATAAACAATTTTACCNGTCCTGCAAACTTGAAGAATAAGAATACNATA
 
. : . : . : . : . : . :
rJMSF030N15+ TAAAGCGTGGTTTGAAGGGGCTTAAATTTCCCNTTTTTTTTTTCTTTTTTCCTGAAAAGA
rJMSF046K23+ TAAAGCGTGGTTTGAAGGGGCTTAAATTTCCCTTTTTTTTTTTCTTTTTTCCTGAAAAGA
                      ____________________________________________________________
consensus TAAAGCGTGGTTTGAAGGGGCTTAAATTTCCCTTTTTTTTTTTCTTTTTTCCTGAAAAGA
 
. : . : . : . : . : . :
rJMSF030N15+ ATGTATTAAGGACTGAAGCTTGCCCCGCTCCAAGGAGATNGAGAGGCTGAGAAACNGNTA
rJMSF046K23+ ATGTATTAAGGA-TGAAGCTTGCCCCGCTCCAAGGAGATTGAGAGGCTGAGAAACTGATA
                      ____________________________________________________________
consensus ATGTATTAAGGACTGAAGCTTGCCCCGCTCCAAGGAGATTGAGAGGCTGAGAAACTGATA
 
. : . : . : . : . : . :
rJMSF030N15+ ATATATATT-CTGGGTATGAACTAAGAAATG
rJMSF046K23+ ATATATATTACTGGGTATGAATTAAGAAATGTAGTTTGAAAACAAAGCCATATGTAAGAG
                      ____________________________________________________________
consensus ATATATATTACTGGGTATGAATTAAGAAATGTAGTTTGAAAACAAAGCCATATGTAAGAG