Previous Contig 013669:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF013A05Sequence326007734 (11)729013669 (10)gb:AB019228_15141043e-61Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCK7.>gb:AY065009_15661
JMSF030I03Sequence662007734 (11)gb:AC144737_17441494e-14Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0018K15, complet704013669 (10)gb:AB019228_15141046e-64Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCK7.>gb:AY065009_15661
JMSF033B05Sequence711007734 (11)gb:AC144737_17441499e-39Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0018K15, complet689013669 (10)gb:AB019228_15141041e-62Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCK7.>gb:AY065009_15661
JMSF035A24Sequence659007734 (11)gb:AF348333_17900842e-30Glycine max candidate plant disease resistance protein gene, partial cds.691013669 (10)gb:AB019228_15141047e-58Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCK7.>gb:AY065009_15661
JMSF040D24Sequence624007734 (11)gb:AP003255_18264413e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045774013669 (10)gb:AB019228_15141041e-65Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCK7.>gb:AY065009_15661
JMSF040H21Sequence693007734 (11)gb:AC144737_17441491e-18Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0018K15, complet807013669 (10)gb:AB019228_15141045e-68Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCK7.>gb:AY065009_15661
JMSF040I09Sequence674007734 (11)gb:AC144737_17441492e-38Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0018K15, complet826013669 (10)gb:AB019228_15141042e-76Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCK7.>gb:AY065009_15661
JMSF046G14Sequence217013669 (10)gb:AB019228_15141041e-23Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCK7.>gb:AY065009_15661
JMSF046G15Sequence266007734 (11)609013669 (10)gb:AB019228_15141043e-49Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCK7.>gb:AY065009_15661
JMSF046K09Sequence809007734 (11)gb:AC144737_17441492e-23Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0018K15, complet777013669 (10)gb:AB019228_15141044e-66Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCK7.>gb:AY065009_15661

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF040I09+ A
                      ____________________________________________________________
consensus A
 
. : . : . : . : . : . :
rJMSF040I09+ CTACTCCAAGGATGAGAAACTCCTGGTTTATGATTTTGTCACTCGA-GGCAGCTTGTCTG
rJMSF040H21+ ATGATTTTGTCACTCGAGGGCAGCTTGTCTG
                      ____________________________________________________________
consensus CTACTCCAAGGATGAGAAACTCCTGGTTTATGATTTTGTCACTCGAGGGCAGCTTGTCTG
 
. : . : . : . : . : . :
rJMSF040I09+ CTNTGATGCATGGGAACAGGGAATCAAGAATGGCACTCGATTGGAATACAAGGTTAAAGA
rJMSF040H21+ CTCTGATGCATGGGAACAGGGAATCAAGAATGGCACTCGATTGGAATACAAGGTTAAAGA
rJMSF040D24+ TGATGCATGGGAACAGGGAATCAAGAATGGCACTCGATTGGAATACAAGGTTAAAGA
rJMSF013A05+ TACAAGGTTAAAGA
rJMSF046K09+ TGATGCATGGGAACAGGAAATCAAGAATGGCACTCGATTGGAATACAAGGTTAAAGA
                      ____________________________________________________________
consensus CTCTGATGCATGGGAACAGGGAATCAAGAATGGCACTCGATTGGAATACAAGGTTAAAGA
 
. : . : . : . : . : . :
rJMSF040I09+ TCGCAGGGGGAGCTGCAAGGGGCGTTGCCCACATACATTCTGTTCCCGGTGCAAGGCTAA
rJMSF040H21+ TCGCAGGGGGAGCTGCAAGGGGCGTTGCCCACATACATTCTGTTCCCGGTGCAAGGCTAA
rJMSF040D24+ TCGCAGGGGGAGCTGCAAGGGGCGTTGCCCACATACATTCTGTTCCCGGTGCAAGGCTAA
rJMSF013A05+ TCGCAGGGGGAGCTGCAAGGGGCGTTGCCCACATACATTCTGTTCCCGGTGCAAGGCTAA
rJMSF033B05+ CAAGGGGCGTTGCCCACATACATTCTGTTCCCGGTGCAAGGCTAA
rJMSF030I03+ AGCTGCAAGGGGCGTTGCCCACATACATTCTGTTCCCGGTGCAAGGCTAA
rJMSF035A24+ GGGCGTTGCCCACATACATTCTGTTCCCGGTGCAAGGCTAA
rJMSF046K09+ TCGCAGGGGGAGCTGCAAGGGGCGTTGCCCACATACATTCTGTTCCCGGTGCAAGGCTAA
                      ____________________________________________________________
consensus TCGCAGGGGGAGCTGCAAGGGGCGTTGCCCACATACATTCTGTTCCCGGTGCAAGGCTAA
 
. : . : . : . : . : . :
rJMSF040I09+ CTCACGGCAATATAAAATNTTCGAATGTCCTCCTCACTCAAGACCTCAACGGATGCATAT
rJMSF040H21+ CTCACGGCAATATAAAATCTTCGAATGTCCTCCTCACTCAAGACCTCAACGGATGCATAT
rJMSF040D24+ CTCACGGCAATATAAAATCTTCGAATGTCCTCCTCACTCAAGACCTCAACGGATGCATAT
rJMSF013A05+ CTCACGGCAATATAAAATCTTCGAATGTCCTCCTCACTCAAGACCTCAACGGATGCATAT
rJMSF033B05+ CTCACGGCAATATAAAATCTTCGAATGTCCTCCTCACTCAAGACCTCAACGGATGCATAT
rJMSF030I03+ CTCACGGCAATATAAAATCTTCGAATGTCCTCCTCACTCAAGACCTCAACGGATGCATAT
rJMSF035A24+ CTCACGGCAATATAAAATCTTCGAATGTCCTCCTCACTCAAGACCTCAACGGATGCATAT
rJMSF046G15+ CCTCACTCAAGACCTCAACGGATGCATAT
rJMSF046K09+ CTCACGGCAATATAAAATCTTCGAATGTCCTCCTCACTCAAGACCTCAACGGATGCATAT
                      ____________________________________________________________
consensus CTCACGGCAATATAAAATCTTCGAATGTCCTCCTCACTCAAGACCTCAACGGATGCATAT
 
. : . : . : . : . : . :
rJMSF040I09+ CGGATTTTGGCCTCACGCCACTTATGGGCTTCACCACAATCCCACCAAGAAGCGCGGGAT
rJMSF040H21+ CGGATTTTGGCCTCACGCCACTTATGGGCTTCACCACAATCCCACCAAGAAGCGCGGGAT
rJMSF040D24+ CGGATTTTGGCCTCACGCCACTTATGGGCTTCACCACAATCCCACCAAGAAGCGCGGGAT
rJMSF013A05+ CGGATTTTGGCCTCACGCCACTTATGGGCTTCACCACAATCCCACCAAGAAGCGCGGGAT
rJMSF033B05+ CGGATTTTGGCCTCACGCCACTTATGGGCTTCACCACAATCCCACCAAGAAGCGCGGGAT
rJMSF046G14+ CCCACCAAGAAGCGCGGGAT
rJMSF030I03+ CGGATTTTGGCCTCACGCCACTTATGGGCTTCACCACAATCCCACCAAGAAGCGCGGGAT
rJMSF035A24+ CGGATTTTGGCCTCACGCCACTTATGGGCTTCACCACAATCCCACCAAGAAGCGCGGGAT
rJMSF046G15+ CGGATTTTGGCCTCACGCCACTTATGGGCTTCACCACAATCCCACCAAGAAGCGCGGGAT
rJMSF046K09+ CGGATTTTGGCCTCACGCCACTTATGGGCTTCACCACAATCCCACCAAGAAGCGCGGGAT
                      ____________________________________________________________
consensus CGGATTTTGGCCTCACGCCACTTATGGGCTTCACCACAATCCCACCAAGAAGCGCGGGAT
 
. : . : . : . : . : . :
rJMSF040I09+ ACCGAGCACCGGAGGTGATTGAAACAAGGAAATCCACCCAAAAATCAGACGTTTACAGCC
rJMSF040H21+ ACCGAGCACCGGAGGTGATTGAAACAAGGAAATCCACCCAAAAATCAGACGTTTACAGCC
rJMSF040D24+ ACCGAGCACCGGAGGTGATTGAAACAAGGAAATCCACCCAAAAATCAGACGTTTACAGCC
rJMSF013A05+ ACCGAGCNCCGGAGGTGATTGAAACAAGGAAATCCACCCAAAAATCAGACGTTTACAGCC
rJMSF033B05+ ACCGAGCACCGGAGGTGATTGAAACAAGGAAATCCACCCAAAAATCAGACGTTTACAGCC
rJMSF046G14+ ACCGAGCACCGGAGGTGATTGAAACAAGGAAATCCNCCCAAAAATCAGACGTTTACAGCC
rJMSF030I03+ ACCGAGCACCGGAGGTGATTGAAACAAGGAAATCCACCCAAAAATCAGACGTTTACAGCC
rJMSF035A24+ ACCGAGCACCGGAGGTGATTGAAACAAGGAAATCCACCCAAAAATCAGACGTTTACAGCC
rJMSF046G15+ ACCGAGCNCCGGAGGTGATTGAAACAAGGAAATCCACCCAAAAATCAGACGTTTACAGCC
rJMSF046K09+ ACCGAGCACCGGAGGTGATTGAAACAAGGAAATCCACCCAAAAATCAGACGTTTACAGCC
                      ____________________________________________________________
consensus ACCGAGCACCGGAGGTGATTGAAACAAGGAAATCCACCCAAAAATCAGACGTTTACAGCC
 
. : . : . : . : . : . :
rJMSF040I09+ TCGGGGTTNTCCTACTCGAACTGCTGACAGGAAAAGCGCCAGTGCAGTCAGCAGCGCAGG
rJMSF040H21+ TCGGGGTTCTCCTACTCGAACTGCTGACAGGAAAAGCGCCAGTGCAGTCAGCAGCGCAGG
rJMSF040D24+ TCGGGGTTCTCCTACTCGAACTGCTGACAGGAAAAGCGCCAGTGCAGTCAGCAGCGCAGG
rJMSF013A05+ TCGGGGTTCTCCTACTCGAACTGCTGACAGGAAAAGCGCCAGTGCAGTCAGCAGCGCAGG
rJMSF033B05+ TCGGGGTTNTCCTACTCGAACTGCTGACAGGAAAAGCGCCAGTGCAGTCAGCAGCGCAGG
rJMSF046G14+ TCGGGGTTNTCCTACTNGAACTGCTGACAGGAAAAGCGCCAGTGCAGTCAGCAGCGCAGG
rJMSF030I03+ TCGGGGTTNTCCTACTCGAACTGCTGACAGGAAAAGCGCCAGTGCAGTCAGCAGCGCAGG
rJMSF035A24+ TCGGGGTTCTCCTACTCGAACTGCTGACAGGAAAAGCGCCAGTGCAGTCAGCAGCGCAGG
rJMSF046G15+ TCGGGGTTCTCCTACTCGAACTGCTGACAGGAAAAGCGCCAGTGCAGTCAGCAGCGCAGG
rJMSF046K09+ TCGGGGTTCTCCTACTCGAACTGCTGACAGGAAAAGCGCCAGTGCAGTCAGCAGCGCAGG
                      ____________________________________________________________
consensus TCGGGGTTCTCCTACTCGAACTGCTGACAGGAAAAGCGCCAGTGCAGTCAGCAGCGCAGG
 
. : . : . : . : . : . :
rJMSF040I09+ AAGAGGTGGTGGATTTGCCAAAATGGGTTCAGTCTGTTGTTAGAGAGGAATGGACTGCAG
rJMSF040H21+ AAGAGGTGGTGGATTTGCCAAAATGGGTTCAGTCTGTTGTTAGAGAGGAATGGACTGCAG
rJMSF040D24+ AAGAGGTGGTGGATTTGCCAAAATGGGTTCAGTCTGTTGTTAGAGAGGAATGGACTGCAG
rJMSF013A05+ AAGAGGTGGTGGATTTGCCAAAATGGGTTCAGTCTGTTGTTAGAGAGGAATGGACTGCAG
rJMSF033B05+ AAGAGGTGGTGGATTTGCCAAAATGGGTTCAGTCTGTTGTTAGAGAGGAATGGACTGCAG
rJMSF046G14+ AAGAGGTGGTGGATTTGCCNAAATGGGTTCAGTCTGTTGTTAGAGAGGAATGGNCTGCAG
rJMSF030I03+ AAGAGGTGGTGGATTTGCCAAAATGGGTTCAGTCTGTTGTTAGAGAGGAATGGACTGCAG
rJMSF035A24+ AAGAGGTGGTGGATTTGCCAAAATGGGTTCAGTCTGTTGTTAGAGAGGAATGGACTGCAG
rJMSF046G15+ AAGAGGTGGTGGATTTGCCAAAATGGGTTCAGTCTGTTGTTAGAGAGGAATGGACTGCAG
rJMSF046K09+ AAGAGGTGGTGGATTTGCCAAAATGGGTTCAGTCTGTTGTTAGAGAGGAATGGACTGCAG
                      ____________________________________________________________
consensus AAGAGGTGGTGGATTTGCCAAAATGGGTTCAGTCTGTTGTTAGAGAGGAATGGACTGCAG
 
. : . : . : . : . : . :
rJMSF040I09+ AGGTGTTTGATGCAGAACTGATCAACTATCATCAGAGTATGGAAGATGAGATGGTGCAGT
rJMSF040H21+ AGGTGTTTGATGCAGAACTGATCAACTATCATCAGAGTATGGAAGATGAGATGGTGCAGT
rJMSF040D24+ AGGTGTTTGATGCAGAACTGATCAACTATCATCAGAGTATGGAAGATGAGATGGTGCAGT
rJMSF013A05+ AGGTGTTTGATGCAGAACTGATCAACTATCATCAGAGTATGGAAGATGAGATGGTGCAGT
rJMSF033B05+ AGGTGTTTGATGCAGAACTGATCAACTATCATCAGAGTATGGAAGATGAGATGGTGCAGT
rJMSF046G14+ AGGTGTTTGATGCAG
rJMSF030I03+ AGGTGTTTGATGCAGAACTGATCAACTATCATCAGAGTATGGAAGATGAGATGGTGCAGT
rJMSF035A24+ AGGTGTTTGATGCAGGACTGATCAACTATCATCAGAGTATGGAAGATGAGATGGTGCAGT
rJMSF046G15+ AGGTGTTTGATGCAGAACTGATCAACTATCATCAGAGTATGGAAGATGAGATGGTGCAGT
rJMSF046K09+ AGGTGTTTGATGCAGAACTGATCAACTATCATCAGAGTATGGAAGATGAGATGGTGCAGT
                      ____________________________________________________________
consensus AGGTGTTTGATGCAGAACTGATCAACTATCATCAGAGTATGGAAGATGAGATGGTGCAGT
 
. : . : . : . : . : . :
rJMSF040I09+ TGCTTCAGGTTGCAATGGCCTGTGTCGGAAAGGTGCCGGAAATGAGGCCTAAGATGGATG
rJMSF040H21+ TGCTTCAGGTTGCAATGGCCTGTGTCGGAAAGGTGCCGGAAATGAGGCCTAAGATGGATG
rJMSF040D24+ TGCTTCAGGTTGCAATGGCCTGTGTCGGAAAGGTGCCGGAAATGAGGCCTAAGATGGATG
rJMSF013A05+ TGCTTCAGGTTGCAATGGCCTGTGTCGGAAAGGTGCCGGAAATGAGGCCTAAGATGGATG
rJMSF033B05+ TGCTTCAGGTTGCAATGGCCTGTGTCGGAAAGGTGCCGGAAATGAGGCCTAAGATGGATG
rJMSF030I03+ TGCTTCAGGTTGCAATGGCCTGTGTCGGAAAGGTGCCGGAAATGAGGCCTAAGATGGATG
rJMSF035A24+ TGCTTCAGGTTGCAATGGCCTGTGTCGGAAAGGTGCCGGAAATGAGGCCTAAGATGGATG
rJMSF046G15+ TGCTTCAGGTTGCAATGGCCTGTGTCGGAAAGGTGCCGGAAATGAGGCCTAAGATGGATG
rJMSF046K09+ TGCTTCAGGTTGCAATGGCCTGTGTCGGAAAGGTGCCGGAAATGAGGCCTAAGATGGATG
                      ____________________________________________________________
consensus TGCTTCAGGTTGCAATGGCCTGTGTCGGAAAGGTGCCGGAAATGAGGCCTAAGATGGATG
 
. : . : . : . : . : . :
rJMSF040I09+ AAGTTGTGAGGATGATTGAGGAAATCCGGCAGCCGGATTTCGACAACCGGCCATCATNTG
rJMSF040H21+ AAGTTGTGAGGATGATTGAGGAAATCCGGCAGCCGGATTTCGACAACCGGCCATCATCTG
rJMSF040D24+ AAGTTGTGAGGATGATTGAGGAAATCCGGCAGCCGGATTTCGACAACCGGCCATCATCTG
rJMSF013A05+ AAGTTGTGAGGATGATTGAGGAAATCCGGCAGCCGGATTTCGACAACCGGCCATCATNTG
rJMSF033B05+ AAGTTGTGAGGATGATTGAGGAAATCCGGCAGCCGGATTTCGNCAACCGGCCATCATNTG
rJMSF030I03+ AAGTTGTGAGGATGATTGAGGAAATCCGGCAGCCGGATTTCGACAACCGGCCATCATNTG
rJMSF035A24+ AAGTTGTGAGGATGATTGAGGAAATCCGGCAGCCGGATTTCGACAACCGGCCATCATCTG
rJMSF046G15+ AAGTTGTGAGGATGATTGAGGAAATCCGGCAGCCGGATTTCGACAACCGGCCATCATCTG
rJMSF046K09+ AAGTTGTGAGGATGATTGAGGAAATCCGGCAGCCGGATTTCGACAACCGGCCATCATCTG
                      ____________________________________________________________
consensus AAGTTGTGAGGATGATTGAGGAAATCCGGCAGCCGGATTTCGACAACCGGCCATCATCTG
 
. : . : . : . : . : . :
rJMSF040I09+ AAGATAACAAGTCTAGGAGCCCAAGCAGCTNTGCTGTATGATGACCATAGCTTTTTATCA
rJMSF040H21+ AAGATAACAAGTCTAGGAGCCCAAGCAGCTCTGCTGTATGATGACCATAGCTTTTTATCA
rJMSF040D24+ AAGATAACAAGTCTAGGAGCCCAAGCAGCTCTGCTGTATGATGACCATAGCTTTTTATCA
rJMSF013A05+ AAGATAACAAGTCTAGGAGCCCAAGCAGCTNTGCTGTATGATGACCATAGCTTTTTATCA
rJMSF033B05+ AAGATAACAAGTNTAGGAGCCCAAGCAGCTNTGCTGTATGATGACCATAGCTTTTTATCA
rJMSF030I03+ AAGATAACAAGTCTAGGAGCCCAAGCAGCTNTGCTGTATGATGACCATAGCTTTTTATCA
rJMSF035A24+ AAGATAACAAGTCTAGGAGCCCAAGCAGCTCTGCTGTATGATGACCATAGCTTTTTATCA
rJMSF046G15+ AAGATAACAAGTCTAGGAGCCCAAGCAGCTNTGCTGTATGATGACCATAGCTTTTTATCA
rJMSF046K09+ AAGATAACAAGTCTAGGAGCCCAAGCAGCTNTGCTGTATGATGACCATAGCTTTTTATCA
                      ____________________________________________________________
consensus AAGATAACAAGTCTAGGAGCCCAAGCAGCTCTGCTGTATGATGACCATAGCTTTTTATCA
 
. : . : . : . : . : . :
rJMSF040I09+ TTTCAGATTTTCAGTCCATTTGTATGTCACCTTTTTAGGTTCATCTCAATTTTTAAAAAT
rJMSF040H21+ TTTCAGATTTTCAGTCCATTTGTATGTCACCTTTTTAGGTTCATCTCAATTTTT-AAAAT
rJMSF040D24+ TTTCAGATTTTCAGTCCATTTGTATGTCACCTTTTTAGGTTCATCTCAATTTTT-AAAAT
rJMSF013A05+ TTTCAGATTTTCAGTCCATTTGTATGTCACCTTTTTAGGTTCATCTCAATTTTTAAAAAT
rJMSF033B05+ TTTCAGATTTTCAGTCCATTTGTATGTCACCTTTTTAGGTTCATCTCAATTTTTAAAAAT
rJMSF030I03+ TTTCAGATTTTCAGTCCATTTGTATGTCACCTTTTTAGGTTCATCTCAATTTTTAAAAAT
rJMSF035A24+ TTTCAGATTTTCAGTCCATTTGTATGTCACCTTTTTAGGTTCATCTCAATTTTTAAAAAT
rJMSF046G15+ TTTCAGATTTTCAGTCCATTTGTATGTCACCTTTTTAGGTTCATCTCAATTTTTAAAAAT
rJMSF046K09+ TTTCAGATTTTCAGTCCATTTGTATGTCACCTTTTTAGGTTCATCTCAATTTTTAAAAAT
                      ____________________________________________________________
consensus TTTCAGATTTTCAGTCCATTTGTATGTCACCTTTTTAGGTTCATCTCAATTTTTAAAAAT
 
. : . : . : . : . : . :
rJMSF040I09+ CCTTTGTCTTTAGCTTCTTCCTTTTTTTTTTAACCCCTTTTTTCAT
rJMSF040H21+ CCTTTGTCTTTAGCTTCTTCCTT-TTTTTTTAACCCCTTTTTTCATGTAATCTTA
rJMSF040D24+ CCTTTGTCTTTAGCTTCTTCCTT-TTTTTTTAACCCCTTTTTTCATGTAATCTTA
rJMSF013A05+ CCTTTGTCTTTAGCTTCTTCCTTTTTTTTTTAACCCCTTTTTTCATGTAATCTTA
rJMSF033B05+ CCTTTGTCTTTAGCTTCTTCCTTTTTTTTTTAACCCCTTTTTTC
rJMSF030I03+ CCTTTGTCTTTAGCTTCTTCCTTTTTTTTTTAACCCCTTTTTTCATGTAATCT
rJMSF035A24+ CCTTTGTCNTTAGCTTCTTCCTTCTTTTTTTAACCCCTTTTTTCATGTAA
rJMSF046G15+ CCTTTGTCTTTAGCTTCTTCCTTTTTTTTTTAACCCCTTT
rJMSF046K09+ CCTTTGTCTTTAGCTTCTTCCTTTTTTTTTTAACCCCTTTTTTCATGTAATCTTAATATT
                      ____________________________________________________________
consensus CCTTTGTCTTTAGCTTCTTCCTTTTTTTTTTAACCCCTTTTTTCATGTAATCTTAATATT