Previous Contig 013666:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF046K01Sequence706007910 (2)gb:AP003346_18284264e-49Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P043818013666 (2)gb:AC137623_17437041e-21Oryza sativa (japonica cultivar-group) chromosome 5 clone P0426G01, complete seq
JMSF049E20Sequence665007910 (2)gb:AP003346_18284262e-31Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P043753013666 (2)gb:AC137623_17437042e-18Oryza sativa (japonica cultivar-group) chromosome 5 clone P0426G01, complete seq

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF049E20+ AAAT
rJMSF046K01+ AGAGGAANGTATATGCATTGCTCAAGAATCAAGCNAAAT
                      ____________________________________________________________
consensus AGAGGAANGTATATGCATTGCTCAAGAATCAAGCNAAAT
 
. : . : . : . : . : . :
rJMSF049E20+ CTGATGATGTACTCAAAGCGGCTTTCCATGCACATATTCTTCTGCACTTCATCAAGTCGT
rJMSF046K01+ NTGATGATGTACTCAAAGCGGCTTTCCATGCACATATTCTTNTGCACTTCATCAAGTCGT
                      ____________________________________________________________
consensus CTGATGATGTACTCAAAGCGGCTTTCCATGCACATATTCTTCTGCACTTCATCAAGTCGT
 
. : . : . : . : . : . :
rJMSF049E20+ CCAATTATCAGTCTTCGTCCGGGAAAGAAATGCAGGGTGATCTCTCTTTTTCCTTGGCAT
rJMSF046K01+ CCAATTATCAGTCTTCGTCCGGGAAAGAAATGCAGGGTGATCTCTCTTTTTCCTTGGCAT
                      ____________________________________________________________
consensus CCAATTATCAGTCTTCGTCCGGGAAAGAAATGCAGGGTGATCTCTCTTTTTCCTTGGCAT
 
. : . : . : . : . : . :
rJMSF049E20+ CCAGTGCTGATCTTCATGCTCATGTTGCAGAATCTTATAAAATGGTCTCAGCTCTGTATG
rJMSF046K01+ CCAGTGCTGATCTTCATGCTCATGTTGCAGAATCTTATAAAATGGTCTCAGCTCTGTATG
                      ____________________________________________________________
consensus CCAGTGCTGATCTTCATGCTCATGTTGCAGAATCTTATAAAATGGTCTCAGCTCTGTATG
 
. : . : . : . : . : . :
rJMSF049E20+ CACCTTTCAAGAGTAAGGCCAAAGAACAGGGGTGGGTAATGTCAGAATCACTGCTTAATC
rJMSF046K01+ CACCTTTCAAGAGTAAGGCCAAAGAACAGGGGTGGGTAATGTCAGAATCACTGCTTAATC
                      ____________________________________________________________
consensus CACCTTTCAAGAGTAAGGCCAAAGAACAGGGGTGGGTAATGTCAGAATCACTGCTTAATC
 
. : . : . : . : . : . :
rJMSF049E20+ CTGGTCGAGCTCGCCTATGTGACTTGGGTGAATAAGAAGATGTTTTCTGCCGTTAATATA
rJMSF046K01+ CTGGTCGAGCTCGCCTATGTGACTTGGGTGAATAAGAAGATGTTTTCTGCCGTTAATATA
                      ____________________________________________________________
consensus CTGGTCGAGCTCGCCTATGTGACTTGGGTGAATAAGAAGATGTTTTCTGCCGTTAATATA
 
. : . : . : . : . : . :
rJMSF049E20+ CTTGTGTGAACATCTGATGTTGGATATAAAAATTTGATAAGCCTGCTTAGACAAGTAACA
rJMSF046K01+ CTTGTGTGAACATCTGATGTTGGATATAAAAATTTGATAAGCCTGCTTAGACAAGTAACA
                      ____________________________________________________________
consensus CTTGTGTGAACATCTGATGTTGGATATAAAAATTTGATAAGCCTGCTTAGACAAGTAACA
 
. : . : . : . : . : . :
rJMSF049E20+ CTCATTTGCACAGTAACAAGATTGTCATGCCTTCTCCCCCCACAAAAATAAAAAACAAGA
rJMSF046K01+ CTCATTTGCACAGTAACAAGATTGTCATGCCTTCTCCCCCCCCAAAAATAAAAAACAAGA
                      ____________________________________________________________
consensus CTCATTTGCACAGTAACAAGATTGTCATGCCTTCTCCCCCCCCAAAAATAAAAAACAAGA
 
. : . : . : . : . : . :
rJMSF049E20+ TCATCCATCGTGCCTTGAGTGTGTATCACGCAGAGCTTCCTGTCATGGCTTGCACAAACT
rJMSF046K01+ TCATCCATCGTGCCTTGAGTGTGTATCACGCAGAGCTTCCTGTCATGGCTTGCACAAACT
                      ____________________________________________________________
consensus TCATCCATCGTGCCTTGAGTGTGTATCACGCAGAGCTTCCTGTCATGGCTTGCACAAACT
 
. : . : . : . : . : . :
rJMSF049E20+ ACAGAATGCGTAAGAGCTGTAAACAGAGATGCAAGAAGATTCTACCTGTGTATGAAAATA
rJMSF046K01+ ACAGAATGCGTAAGAGCTGTAAACAGAGATGCAAGAAGATTCTACCTGTGTATGAAAATA
                      ____________________________________________________________
consensus ACAGAATGCGTAAGAGCTGTAAACAGAGATGCAAGAAGATTCTACCTGTGTATGAAAATA
 
. : . : . : . : . : . :
rJMSF049E20+ GTAGCTTGCATTTCCGCAATGTAAGCAAGAAATAACCTCTCCTATCAGAGTTGTCAGCGT
rJMSF046K01+ GTAGCTTGCATTTCCGCAATGTAAGCAAGAAATAACCTCTCCTATCAGAGTTGTCAGCGT
                      ____________________________________________________________
consensus GTAGCTTGCATTTCCGCAATGTAAGCAAGAAATAACCTCTCCTATCAGAGTTGTCAGCGT
 
. : . : . : . : . : . :
rJMSF049E20+ TCGTGTAAATTTTGTTAAATTTTTTTCATGTTTGTTTTTCTATTAGGTGCTTTTGGCTGT
rJMSF046K01+ TCGTGTAAATTTTGTTAAATTTTTTTCATGTTTGTTTTTCTATTAGGTGCTTTTGGCTGT
                      ____________________________________________________________
consensus TCGTGTAAATTTTGTTAAATTTTTTTCATGTTTGTTTTTCTATTAGGTGCTTTTGGCTGT
 
. : . : . : . : . : . :
rJMSF049E20+ TGTTAACAGTATGAGGTGCATAATGTTTAGAGCATAACCATGTATGCTTTTATTATGATT
rJMSF046K01+ TGTTAACAGTATGAGGTGCATAATGTTTAGAGCATAA-CATGTATGCTTTTATTATGATT
                      ____________________________________________________________
consensus TGTTAACAGTATGAGGTGCATAATGTTTAGAGCATAACCATGTATGCTTTTATTATGATT
 
. : . : . : . : . : . :
rJMSF049E20+ TGCGAGTGTGTTATGTAAACCCCTA
rJMSF046K01+ TGCGAGTGTGTTATGTAAACCCCTATTAGCATAGTGTATATAGCATGATTTATATGCTTT
                      ____________________________________________________________
consensus TGCGAGTGTGTTATGTAAACCCCTATTAGCATAGTGTATATAGCATGATTTATATGCTTT