Previous Contig 013662:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF013A23Sequence225005364 (3)585013662 (3)gb:LES303345_16845592e-24Lycopersicon esculentum lateral suppressor gene, ORF1 and ORF2.
JMSF024M03Sequence638005364 (3)gb:LES303345_16845591e-33Lycopersicon esculentum lateral suppressor gene, ORF1 and ORF2.602013662 (3)gb:LES303345_16845598e-45Lycopersicon esculentum lateral suppressor gene, ORF1 and ORF2.
JMSF046J05Sequence722005364 (3)gb:LES303345_16845592e-33Lycopersicon esculentum lateral suppressor gene, ORF1 and ORF2.733013662 (3)gb:LES303345_16845594e-56Lycopersicon esculentum lateral suppressor gene, ORF1 and ORF2.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF046J05+ TTACCNTGAACCAA
                      ____________________________________________________________
consensus TTACCNTGAACCAA
 
. : . : . : . : . : . :
rJMSF046J05+ ACCGTGAAAGAAGCATTGAAATGCATGCATGATGGCCAACAGCATTGTGCTCTTGTGGTT
                      ____________________________________________________________
consensus ACCGTGAAAGAAGCATTGAAATGCATGCATGATGGCCAACAGCATTGTGCTCTTGTGGTT
 
. : . : . : . : . : . :
rJMSF024M03+ CTAACATATGGAGACATCAAGCGAAGTTTATTT
rJMSF046J05+ GACAGTGAAGGTTATCTTGAAGGAANTCTAACATANGGAGACATCAAGCGAAGTTTNTTT
                      ____________________________________________________________
consensus GACAGTGAAGGTTATCTTGAAGGAANTCTAACATATGGAGACATCAAGCGAAGTTTATTT
 
. : . : . : . : . : . :
rJMSF024M03+ AAGAACTCTGGGGATTCTCCCAACATGGAATTTTTACATACAGATGAAAATACATGTCTT
rJMSF013A23+ TGGGGANTCTCCCAACATGGAATTTTTNCATNCAGATGNAAATACATGTCTT
rJMSF046J05+ AAGAACTNTGGGGATTCTCCCAACATGGAATTTTTACATACAGATGAAAATACATGTCTT
                      ____________________________________________________________
consensus AAGAACTCTGGGGATTCTCCCAACATGGAATTTTTACATACAGATGAAAATACATGTCTT
 
. : . : . : . : . : . :
rJMSF024M03+ GTCTCCTCCATATGCACAAGAGGAATAAGCTACCTTGGAAGAGAATGCGGACTCTTAACT
rJMSF013A23+ GTCTCCTCCATATGCACAAGNGGAATAAGCTACCNTGGAAGAGAATGCGGACTCTTAACT
rJMSF046J05+ GTCTCCTCCATATGCACAAGAGGAATAAGNTNCCTTGGAAGAGAATGCGGACTTTTAACT
                      ____________________________________________________________
consensus GTCTCCTCCATATGCACAAGAGGAATAAGCTACCTTGGAAGAGAATGCGGACTCTTAACT
 
. : . : . : . : . : . :
rJMSF024M03+ TGTTATCCAGATACCGAATTGGCAATGGCAAAGCAACTAATGGAGGCTAAAGGAATTAAA
rJMSF013A23+ TGTTATCCAGATNCCGAATTGGCAANGGCAAAGCAACTAATGGAGGCTAAAGGAATTAAA
rJMSF046J05+ TGTTATCCAGATACCGAATTGGCAATGGCAAAGCAACTAATGGAGGCTAAAGGAATTAAA
                      ____________________________________________________________
consensus TGTTATCCAGATACCGAATTGGCAATGGCAAAGCAACTAATGGAGGCTAAAGGAATTAAA
 
. : . : . : . : . : . :
rJMSF024M03+ CAGTTGCCGATTGTTAAGCGTGGTAGAGACGCCCAAAAAGAAAGAAAACGTAGAGCCA-T
rJMSF013A23+ CAGTTGCCGATTGTTAAGCGTGGTAGAGACGCCCAAAAAGAAAGAAAACGTAGAGCCACT
rJMSF046J05+ CAGTTGCNGATTGTTAAGCGTGGTAGAGACNCCCAAAAAGAAAGAAAACGTAGANCCA-T
                      ____________________________________________________________
consensus CAGTTGCCGATTGTTAAGCGTGGTAGAGACGCCCAAAAAGAAAGAAAACGTAGAGCCA-T
 
. : . : . : . : . : . :
rJMSF024M03+ TGCTATTTTGAATTATGGTTCGATTTGGGATTCTATCAGAAAAGAGGTTAATTGGCACAA
rJMSF013A23+ TGCTATTTTGAATTATGGTTCGATTTGGGATTCTATCAGAAAAGAGGTTAATTGGCACAA
rJMSF046J05+ TGCTATTCTGAATTATGGTTCGATTTGGGATTCTATCAGAAAAGAGGTTAATTGGCACAA
                      ____________________________________________________________
consensus TGCTATTTTGAATTATGGTTCGATTTGGGATTCTATCAGAAAAGAGGTTAATTGGCACAA
 
. : . : . : . : . : . :
rJMSF024M03+ GTCAGCCTATCAGCAGGCAAGAGGAGACAATTCAAATCAGATAGTTCCAATTGGCCATTG
rJMSF013A23+ GTCAGCCTNTCAGCAGGCAAGAGGAGNCAATTCAAATCNGNTAGTTCCAATTGGCCNTTG
rJMSF046J05+ GTCAGCCTATCAGCAGGCAAGAGGAGACAATTCAAATCAGATAGTTCCAATTGGCCATTG
                      ____________________________________________________________
consensus GTCAGCCTATCAGCAGGCAAGAGGAGACAATTCAAATCAGATAGTTCCAATTGGCCATTG
 
. : . : . : . : . : . :
rJMSF024M03+ ACTGCACAAAGGGTGTTTTGATTCACAGAAAACATACTTAAAAAGCCTTCTGGTTTCCGC
rJMSF013A23+ ACTGCACAAAGGGNGTTTTGATTCACAGAAAACATACTTAAAAAGCCTTCTGGTTTCCGC
rJMSF046J05+ ACTGCACAAAGGGTGTTTTGATTCACAGAAAACATACTTAAAAAGCCTTCTGGTTTCCGN
                      ____________________________________________________________
consensus ACTGCACAAAGGGTGTTTTGATTCACAGAAAACATACTTAAAAAGCCTTCTGGTTTCCGC
 
. : . : . : . : . : . :
rJMSF024M03+ TTCGCTTGGTATAGAGCAATCATCTTATTCATTGATGAGAAATCCTATAGAATTGTCCTT
rJMSF013A23+ TTCGCTTGGTATAGAGCAATCATCTTATTCATTGATGNGAAATCCTATAGAATTGTCCNT
rJMSF046J05+ TTCGCTTGGTATAGAGCAATCATCTTATTCATTGATGAGAAATCCTATAGAATTGTCCTT
                      ____________________________________________________________
consensus TTCGCTTGGTATAGAGCAATCATCTTATTCATTGATGAGAAATCCTATAGAATTGTCCTT
 
. : . : . : . : . : . :
rJMSF024M03+ TTTTTTTGGTGCTACAAGTGTAGTAATAGGCTCCCCTCTTGGCA-CATGGGA-GTATTTT
rJMSF013A23+ TTTNTNTGGTGCTACAAGTGTAGTAATAGGCTCCCCTCTTGGCA-CATGGGA-GTATTTN
rJMSF046J05+ TTTTTTTGGTGCTACAAGTGTAGTAATAGGCTCCCCTCTTGGCAGCATGGGAGGTATTTT
                      ____________________________________________________________
consensus TTTTTTTGGTGCTACAAGTGTAGTAATAGGCTCCCCTCTTGGCA-CATGGGA-GTATTTT
 
. : . : . : . : . : . :
rJMSF024M03+ GCTTAAA-CCCGTGATG-AGGGTTTTGTCT
rJMSF013A23+ GCTTAAA-CCCGTGATG-AGGGTTTNGTC-TCTAGTTCCATTCGA-GTGTAATATAT
rJMSF046J05+ GCTTAAAGCCCGTGATGAAGGGTTTTGTCTTCTAGTTCCATTCGAGGTGTAATATATNAC
                      ____________________________________________________________
consensus GCTTAAA-CCCGTGATG-AGGGTTTTGTCTTCTAGTTCCATTCGAGGTGTAATATATNAC