Previous Contig 013660:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF046I23Sequence674013660 (2)gb:AP005879_18595548e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJN754013660 (2)gb:AY054681_15633353e-57Arabidopsis thaliana putative protein (At4g38260; F22I13.30) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046I23- GTCTCTGCGCAGACATCATCCTCCATTCATCTTCTTCTCCCGTTGCCTCCCTCGCATG
                      ____________________________________________________________
consensus GTCTCTGCGCAGACATCATCCTCCATTCATCTTCTTCTCCCGTTGCCTCCCTCGCATG
 
. : . : . : . : . : . :
JMSF046I23- TCTGAACGCTCTCTCCTCTATCGATCACTTCTCCAGTCACAAGAACAAACGGTTTCGACC
                      ____________________________________________________________
consensus TCTGAACGCTCTCTCCTCTATCGATCACTTCTCCAGTCACAAGAACAAACGGTTTCGACC
 
. : . : . : . : . : . :
JMSF046I23- TCCGTTCATACTCGTCTAGCCATTAATCTAACATCTTTTACGACGCTCATATGAGAATCG
                      ____________________________________________________________
consensus TCCGTTCATACTCGTCTAGCCATTAATCTAACATCTTTTACGACGCTCATATGAGAATCG
 
. : . : . : . : . : . :
JMSF046I23- GTAGCCAAGGTTGAAGGAACCAGACAGCACTACTTGATCTTGCTTTCCTGGATAGTTTTG
                      ____________________________________________________________
consensus GTAGCCAAGGTTGAAGGAACCAGACAGCACTACTTGATCTTGCTTTCCTGGATAGTTTTG
 
. : . : . : . : . : . :
JMSF046I23- GGAGATTGCATGAAAGAAGCAAAGAGACACCCAAGACTGTGAAACTGCTCACTCCCCTTG
                      ____________________________________________________________
consensus GGAGATTGCATGAAAGAAGCAAAGAGACACCCAAGACTGTGAAACTGCTCACTCCCCTTG
 
. : . : . : . : . : . :
JMSF046I23- TCGCCTATTCCCAAACAAAGTGACCATTCAGCTTCCTCAGGTCAACGCTTCTAGCTTTGG
                      ____________________________________________________________
consensus TCGCCTATTCCCAAACAAAGTGACCATTCAGCTTCCTCAGGTCAACGCTTCTAGCTTTGG
 
. : . : . : . : . : . :
JMSF046I23- TGTGAATTGATGAAACACAATGTGTATAGCTGCATTCCAATGGAAAGCTCATCCGATCTA
                      ____________________________________________________________
consensus TGTGAATTGATGAAACACAATGTGTATAGCTGCATTCCAATGGAAAGCTCATCCGATCTA
 
. : . : . : . : . : . :
JMSF046I23- CCCCTTTCTTCTGTTCCTCAACCGGGACGAATACTATGATCGGCCGACGAAGGCTTTGGC
                      ____________________________________________________________
consensus CCCCTTTCTTCTGTTCCTCAACCGGGACGAATACTATGATCGGCCGACGAAGGCTTTGGC
 
. : . : . : . : . : . :
JMSF046I23- GTGGTGGGAGGATGGTGTGATTCTTGGAGGAAGAGACGTTCTCGCCGGTGGGACTTGGCT
rJMSF046I23+ GAGGAAGAGACGTTCTCGCCGGTGGGACTTGGCT
                      ____________________________________________________________
consensus GTGGTGGGAGGATGGTGTGATTCTTGGAGGAAGAGACGTTCTCGCCGGTGGGACTTGGCT
 
. : . : . : . : . : . :
JMSF046I23- AGGCTGTAACCTCAAGGGAAAAATCGCTTTCCTTACCAATGTCCGGGAGGTCGTCGATTT
rJMSF046I23+ AGGCTGTAACCTCAAGGGAAAAATCGCTTTCCTTACCAATGTCCGGGAGGTCGTCGATTT
                      ____________________________________________________________
consensus AGGCTGTAACCTCAAGGGAAAAATCGCTTTCCTTACCAATGTCCGGGAGGTCGTCGATTT
 
. : . : . : . : . : . :
JMSF046I23- GCCGTCTTCTCATACCAAGAGCAGAGGAGACCTTCCTGTTCGCTTCTTACGGAGCAATAA
rJMSF046I23+ GCCGTCTTCTCATACCAAGAGCAGAGGAGACCTTCCTGTTCGCTTCTTACGGAGCAATAA
                      ____________________________________________________________
consensus GCCGTCTTCTCATACCAAGAGCAGAGGAGACCTTCCTGTTCGCTTCTTACGGAGCAATAA
 
. : . : . : . : . : . :
JMSF046I23- GAGCCCTCGTGATTTC
rJMSF046I23+ GAGCCCTCGTGATTTCGCGGAGGAACTTATGGCAGAAGCTGACCATTTTGGTGGGTTTAA
                      ____________________________________________________________
consensus GAGCCCTCGTGATTTCGCGGAGGAACTTATGGCAGAAGCTGACCATTTTGGTGGGTTTAA
 
. : . : . : . : . : . :
rJMSF046I23+ CCTGATAGTAGTTGATATCTGTTCCATGACCATGTTTTATATAACCAACAGACCAAAAGA
                      ____________________________________________________________
consensus CCTGATAGTAGTTGATATCTGTTCCATGACCATGTTTTATATAACCAACAGACCAAAAGA
 
. : . : . : . : . : . :
rJMSF046I23+ CAGAGGTGTATCAGTGACAGAGGTATCGCCTGGTATTCATGTCTTGACAAATGCATCACT
                      ____________________________________________________________
consensus CAGAGGTGTATCAGTGACAGAGGTATCGCCTGGTATTCATGTCTTGACAAATGCATCACT
 
. : . : . : . : . : . :
rJMSF046I23+ AGACTCTCCGTGGCCTAAGGCTCAACGGTTACAAAAAGGTTTCAAGTTGGTGTTGGAAGA
                      ____________________________________________________________
consensus AGACTCTCCGTGGCCTAAGGCTCAACGGTTACAAAAAGGTTTCAAGTTGGTGTTGGAAGA
 
. : . : . : . : . : . :
rJMSF046I23+ ATATGGTGAATCTGAAATTCCATTGGAGTCAGTGGGGAAACAATTGATGAAAGACACAAC
                      ____________________________________________________________
consensus ATATGGTGAATCTGAAATTCCATTGGAGTCAGTGGGGAAACAATTGATGAAAGACACAAC
 
. : . : . : . : . : . :
rJMSF046I23+ AAAAGATGAGGAAAGGAACCTTCTTCCTGGCATCTATGCACCTGAAAGGGAGTACCAATA
                      ____________________________________________________________
consensus AAAAGATGAGGAAAGGAACCTTCTTCCTGGCATCTATGCACCTGAAAGGGAGTACCAATA
 
. : . : . : . : . : . :
rJMSF046I23+ TAGTTCCATATTTGTTGAAGCAGAAGAAGATTTGGTGGGGCGTTATGGCACTAGAAGTAC
                      ____________________________________________________________
consensus TAGTTCCATATTTGTTGAAGCAGAAGAAGATTTGGTGGGGCGTTATGGCACTAGAAGTAC
 
. : . : . : . : . : . :
rJMSF046I23+ TTCTGCATTGGCTATCAAGAATTCCCTAGAGGTCAACTTCTATGAGATGTGTCTTGAGAA
                      ____________________________________________________________
consensus TTCTGCATTGGCTATCAAGAATTCCCTAGAGGTCAACTTCTATGAGATGTGTCTTGAGAA
 
. : . : . : . : . : . :
rJMSF046I23+ TGATTTGTGGAAGGAACAAACCATTTCCTTCAAGATTGAGAAATCTCCAACCCCGGCCCA
                      ____________________________________________________________
consensus TGATTTGTGGAAGGAACAAACCATTTCCTTCAAGATTGAGAAATCTCCAACCCCGGCCCA
 
. : . : . : . : . : . :
rJMSF046I23+ TAAATTCTATGATTCTGTTTAAACTTACTTGGATTTGTGTTGTATTGCTATTATGATCAT
                      ____________________________________________________________
consensus TAAATTCTATGATTCTGTTTAAACTTACTTGGATTTGTGTTGTATTGCTATTATGATCAT