Previous Contig 013653:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001M17Sequence514007722 (5)pir|T06401|T064013e-20malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) precur756013653 (6)gb:VVU67426_17275472e-86Vitis vinifera malate dehydrogenase (VVME2) mRNA, complete cds.
JMFF004B16Sequence593007722 (5)pir|T06401|T064011e-44malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) precur720013653 (6)gb:VVU67426_17275472e-75Vitis vinifera malate dehydrogenase (VVME2) mRNA, complete cds.
JMSF025A22Sequence608013653 (6)gb:VVU67426_17275477e-94Vitis vinifera malate dehydrogenase (VVME2) mRNA, complete cds.717013653 (6)gb:VVU67426_17275471e-76Vitis vinifera malate dehydrogenase (VVME2) mRNA, complete cds.
JMSF035F07Sequence690007502 (9)gb:AF180292_17748035e-28Medicago truncatula MTD1 mRNA, complete cds.464013653 (6)sp|P51615|MAOX_VITVI4e-31NADP-dependent malic enzyme (EC 1.1.1.40) (NADP-ME).>gb:VIIMDN_1727233 Vitis vin
JMSF046G19Sequence674007722 (5)pir|T06401|T064012e-47malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) precur661013653 (6)gb:AY056819_15638641e-62Flaveria brownii NADP-dependent malic enzyme mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF025A22- GGGGGGGCACTGGCATTGCT
                      ____________________________________________________________
consensus GGGGGGGCACTGGCATTGCT
 
. : . : . : . : . : . :
JMSF025A22- GAACTCATTGCGCTCGAGATGTCAAAACAGACGGGAGCCCCATTGGAAGAAACTCGGAAG
                      ____________________________________________________________
consensus GAACTCATTGCGCTCGAGATGTCAAAACAGACGGGAGCCCCATTGGAAGAAACTCGGAAG
 
. : . : . : . : . : . :
JMSF025A22- AAAATTTGGCTGGTGGACTCCAAAGGGCTGATTGTTAAGTCCCGGGTGGAATCACTTCAG
                      ____________________________________________________________
consensus AAAATTTGGCTGGTGGACTCCAAAGGGCTGATTGTTAAGTCCCGGGTGGAATCACTTCAG
 
. : . : . : . : . : . :
JMSF025A22- CACTTTAAAAGGCCGTGGGCCCACGAACACGAGCCCGTAAAGGATCTTGTGGATGCAGTG
rJMFF001M17+ CTTGTGGATGCAGTG
                      ____________________________________________________________
consensus CACTTTAAAAGGCCGTGGGCCCACGAACACGAGCCCGTAAAGGATCTTGTGGATGCAGTG
 
. : . : . : . : . : . :
JMSF025A22- AAGGCTATCAAGCCTACGGTCTTGATTGGATCTTCTGGAGCTGGAAGAACGTTCACG-AA
rJMFF001M17+ AAGGCTATCAAGCCTACGGTCTTGATTGGATCTTCTGGAGCTGGAAGAACGTTCACG-AA
rJMFF004B16+ GTCTTGATTGGATCTTCTGGAGCTGGAAGAACGTTCACGAAA
rJMSF025A22+ GAGCTGGAAGAACGTTCACG-AA
                      ____________________________________________________________
consensus AAGGCTATCAAGCCTACGGTCTTGATTGGATCTTCTGGAGCTGGAAGAACGTTCACG-AA
 
. : . : . : . : . : . :
JMSF025A22- AGATGTTATTGGAGCTATGGCTTCCTTCAACGAGAAACCTATCGTTCTTGCTCTCTCGAA
rJMFF001M17+ AGATGTTATTGGAGCTATGGCTTCCTTCAACGAGAAACCTATCGTTCTTGCTCTCTCGAA
rJMFF004B16+ AGATGTTATTGGAGCTATGGCTTCCTTCAACGAGAAACCTATCGTTCTTGCTCTCTCGAA
rJMSF025A22+ AGATGTTATTGGAGCTATGGCTTCCTTCAACGAGAAACCTATCGTTCTTGCTCTCTCGAA
                      ____________________________________________________________
consensus AGATGTTATTGGAGCTATGGCTTCCTTCAACGAGAAACCTATCGTTCTTGCTCTCTCGAA
 
. : . : . : . : . : . :
JMSF025A22- CCCAACATCGCAGTCGGAGTGTACCGCGGAAGAGGCGTATACCTGGAGTGAGGGCCGAGC
rJMFF001M17+ CCCAACATCGCAGTCGGAGTGTACCGCGGAAGAGGCGTATACCTGGAGTGAGGGCCGAGC
rJMFF004B16+ CCCAACATCGCAGTCGGAGTGTACCGCGGAAGAGGCGTATACCTGGAGTGAGGGCCGAGC
rJMSF025A22+ CCCAACATCGCAGTCGGAGTGTACCGCGGAAGAGGCGTATACCTGGAGTGAGGGCCGAGC
rJMSF046G19+ AACATCGCAGTCGGAGTGTACCGCGGAAGAGGCGTATACCTGGAGTGAGGGCCGAGC
                      ____________________________________________________________
consensus CCCAACATCGCAGTCGGAGTGTACCGCGGAAGAGGCGTATACCTGGAGTGAGGGCCGAGC
 
. : . : . : . : . : . :
JMSF025A22- TATATTTGCCAGTGGAAGCCCATTCCCCCCTTTCGAATACAAGGGGAGGACCCTTTTGTC
rJMFF001M17+ TATATTTGCCAGTGGAAGCCCATTCCCCCCTTTCGAATACAAGGGGAGGACCCTTTTGTC
rJMFF004B16+ TATATTTGCCAGTGGAAGCCCATTCCCCCCTTTCGAATACAAGGGGAGGACCCTTTNGTC
rJMSF025A22+ TATATTTGCCAGTGGAAGCCCATTCCCCCCTTTCGAATACAAGGGGAGGACCCTTTTGTC
rJMSF046G19+ TATATTTGCCAGTGGAAGCCCATTCCCCCCTTTCGAATACAAGGGGAGGACCCTTTTGTC
                      ____________________________________________________________
consensus TATATTTGCCAGTGGAAGCCCATTCCCCCCTTTCGAATACAAGGGGAGGACCCTTTTGTC
 
. : . : . : . : . : . :
JMSF025A22- CGGGCAGGCAAACAATGCATATATCTTCCCCGGGTTTGGTTTAGGACTCATAATTTCGGG
rJMFF001M17+ CGGGCAGGCAAACAATGCATATATCTTCCCCGGGTTTGGTTTAGGACTCATAATTTCGGG
rJMFF004B16+ CGGGCAGGCAAACAATGCATATATCTTCCCCGGGTTTGGTTTAGGACTCATAATTTCGGG
rJMSF025A22+ CGGGCAGGCAAACAATGCATATATCTTCCCCGGGTTTGGTTTAGGACTCATAATTTCGGG
rJMSF046G19+ CGGGCAGGCAAACAATGCATATATCTTCCCCGGGTTTGGTTTAGGACTCATAATTTCGGG
                      ____________________________________________________________
consensus CGGGCAGGCAAACAATGCATATATCTTCCCCGGGTTTGGTTTAGGACTCATAATTTCGGG
 
. : . : . : . : . : . :
JMSF025A22- TGCAATCCGTGTCCACGATGACATGCTTCTTGCGGCCTCGGAAGCTCTAGCTGCCGAGGT
rJMFF001M17+ TGCAATCCGTGTCCACGATGACATGCTTCTTGCGGCCTCGGAAGCTCTAGCTGCCGAGGT
rJMFF004B16+ TGCAATCCGTGTCCACGATGACATGCTTCTTGCGGCCTCGGAAGCTCTAGCTGCCGAGGT
rJMSF025A22+ TGCAATCCGTGTCCACGATGACATGCTTCTTGCGGCCTCGGAAGCTCTAGCTGCCGAGGT
rJMSF035F07+ CCACGATGACATGCTTCTTGCGGCCTCGGAAGCTCTAGCTGCCGAGGT
rJMSF046G19+ TGCAATCCGTGTCCACGATGACATGCTTCTTGCGGCCTCGGAAGCTCTAGCTGCCGAGGT
                      ____________________________________________________________
consensus TGCAATCCGTGTCCACGATGACATGCTTCTTGCGGCCTCGGAAGCTCTAGCTGCCGAGGT
 
. : . : . : . : . : . :
JMSF025A22- TACGCAAGAGAACTTCGATAAAGGACTCATATACCCTCCGTTTTCGAAC
rJMFF001M17+ TACGCAAGAGAACTTCGATAAAGGACTCATATACCCTCCGTTTTCGAACATCAGAAAAAT
rJMFF004B16+ TACGCAAGAGAACTTCGATAAAGGACTCATATACCCTCCGTTTTCGAACATCAGAAAAAT
rJMSF025A22+ TACGCAAGAGAACTTCGATAAAGGACTCATATACCCTCCGTTTTCGAACATCAGAAAAAT
rJMSF035F07+ TACGCAAGAGAACTTCGATAAAGGACTCATATACCCTCCGTTTTCGAACATCAGAAAAAT
rJMSF046G19+ TACGCAAGAGGACTTCGATAAAGGACTCATATACCCTCCGTTTTCGAACATCAGAAAAAT
                      ____________________________________________________________
consensus TACGCAAGAGAACTTCGATAAAGGACTCATATACCCTCCGTTTTCGAACATCAGAAAAAT
 
. : . : . : . : . : . :
rJMFF001M17+ CTCGGCCCATATTGCCGCCAGAGTAGCCGCCAAAGCATATGAACTCGGTTTGGCCACTCG
rJMFF004B16+ CTCGGCCCATATTGCCGCCAGAGTAGCCGCCAAAGCATATGAACTCGGTTTGGCCACTCG
rJMSF025A22+ CTCGGCCCATATTGCCGCCAGAGTAGCCGCCAAAGCATATGAACTCGGTTTGGCCACTCG
rJMSF035F07+ CTCGGCCCATATTGCCGCCAGAGTAGCCGCCAAAGCATATGAACTCGGTTTGGCCACTCG
rJMSF046G19+ CTCGGCCCATATTGCCGCCAGAGTAGCCGCCAAAGCATATGAACTCGGTTTGGCCACTCG
                      ____________________________________________________________
consensus CTCGGCCCATATTGCCGCCAGAGTAGCCGCCAAAGCATATGAACTCGGTTTGGCCACTCG
 
. : . : . : . : . : . :
rJMFF001M17+ TCTACCACAACCCGAAAACCTGGTTGCTTATGCCGAGAGCTGCATGTACAGCCCTACTTA
rJMFF004B16+ TCTACCACAACCCGAAAACCTGGTTGCTTATGCCGAGAGCTGCATGTACAGCCCTACTTA
rJMSF025A22+ TCTACCACAACCCGAAAACCTGGTTGCTTATGCCGAGAGCTGCATGTACAGCCCTACTTA
rJMSF035F07+ TCTACCACAACCCGAAAACCTGGTTGCTTATGCCGAGAGCTGCATGTACAGCCCTACTTA
rJMSF046G19+ TCTACCACAACCCGAAAACCTGGTTGCTTATGCCGAGAGCTGCATGTACAGCCCTACTTA
                      ____________________________________________________________
consensus TCTACCACAACCCGAAAACCTGGTTGCTTATGCCGAGAGCTGCATGTACAGCCCTACTTA
 
. : . : . : . : . : . :
rJMFF001M17+ CCGTAGCTATCGCTAAGCGGTTGGAAGATTTACTCTTTTTAAGATTTAGATAGTTAAGTC
rJMFF004B16+ CCGTAGCTATCGCTAAGCGGTTGGAAGATTTACTCTTTTTAAGATTTAGATAGTTAAGTC
rJMSF025A22+ CCGTAGCTATCGCTAAGCGGTTGGAAGATTTACTCCTTTTAAGATTTAGATAGTTAAGTC
rJMSF035F07+ CCGTAGCTATCGCTAAGCGGTTGGAAGATTTACTCTTTTTAAGATTTAGATAGTTAAGTC
rJMSF046G19+ CCGTAGCTATCGCTAAGCGGTTGGAAGATTTACTCTTTTTAAGATTTAGATAGTTAAGTC
                      ____________________________________________________________
consensus CCGTAGCTATCGCTAAGCGGTTGGAAGATTTACTCTTTTTAAGATTTAGATAGTTAAGTC
 
. : . : . : . : . : . :
rJMFF001M17+ TTTATTTTATTTTTTTCTTCTTTTTACATTTTGAATATGTGGTTTTAATTATTGAAGTTG
rJMFF004B16+ TTTATTTTATTTTTTTCTTCTTTTTACATTTTGAATATGTGGTTTTAATTATTGAAGTTG
rJMSF025A22+ TTTATTTTATTTTTTTCTTCTTTTTACATTTTGAATATGTGGTTTTAATTATTGAAGTTG
rJMSF035F07+ TTTATTTTATTTTTTTCTTCTTTTTACATTTTGAATATGTGGTTTTAATTATTGAAGTTG
rJMSF046G19+ TTTATTTTATTTTTTTCTTCTTTTTACATTTTGAATATGTGGTTTTAATTATTGAAGTTG
                      ____________________________________________________________
consensus TTTATTTTATTTTTTTCTTCTTTTTACATTTTGAATATGTGGTTTTAATTATTGAAGTTG
 
. : . : . : . : . : . :
rJMFF001M17+ AGGGTGTTTTTAGGAGCAGGTTTAAGGTTAGATTGCAGAAATGTT-TGTGCTAGTGATGA
rJMFF004B16+ AGGGTGTTTTTAGGAGCAGGTTTAAGGTTAGATTGCAGAAATTTTGTGTGCTAGTGATGA
rJMSF025A22+ AGGGTGTTTTTAGGAGCAGGTTTAAGGTTAGATTGCAGAAATGTTGTGTGCTAGTGATGA
rJMSF035F07+ AGGGTGTTTTTAGGAGCAGGTTTAAGGTTAGATTGCAGAAATGTTGTGTGCTAGTGATGA
rJMSF046G19+ AGGGTGTTTTTAGGAGCAGGTTTAAGGTTAGATTGCAGAAATGTTGTGTGCTAGTGATGA
                      ____________________________________________________________
consensus AGGGTGTTTTTAGGAGCAGGTTTAAGGTTAGATTGCAGAAATGTTGTGTGCTAGTGATGA
 
. : . : . : . : . : . :
rJMFF001M17+ ACTGATGA
rJMFF004B16+ ACTGATGATGTTAAAAAA
rJMSF025A22+ ACTGATGATGTTAAAAAAATANGAAAGTTTTTTAC
rJMSF035F07+ ACTGATGATGTTAAAAAAATAAGAAAGTTTTTTACTACT
rJMSF046G19+ ACTGATGATGTTAAAAAAATAAGAAAGTTTTTTACTACTTGAAAACCATATGTAGCTAAA
                      ____________________________________________________________
consensus ACTGATGATGTTAAAAAAATAAGAAAGTTTTTTACTACTTGAAAACCATATGTAGCTAAA