Previous Contig 013646:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS107C12Sequence626013646 (2)gb:OSJN00093_16947781e-34Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0093O08, complete seque
JMSF046F02Sequence716000457 (14)gb:AC132489_17411835e-53Oryza sativa (japonica cultivar-group) chromosome 5 clone P0537C11, complete seq700013646 (2)gb:AB023482_15156022e-16Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, clone P0680A03

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS107C12- GAGAGAGAACTAGTCGCAGCATCGTTCTACGTGGGCTC
                      ____________________________________________________________
consensus GAGAGAGAACTAGTCGCAGCATCGTTCTACGTGGGCTC
 
. : . : . : . : . : . :
JMFS107C12- GAACGATCGTTGGGGGGTGAGCAGTTCTGGAACATTCATTCACAACCCAAACGGACCGAA
                      ____________________________________________________________
consensus GAACGATCGTTGGGGGGTGAGCAGTTCTGGAACATTCATTCACAACCCAAACGGACCGAA
 
. : . : . : . : . : . :
JMFS107C12- GTTTACAGCTCAGACGGATTCTCAGATCACAAGCACTCTCGACTCTGAGCTCTACAAAAC
                      ____________________________________________________________
consensus GTTTACAGCTCAGACGGATTCTCAGATCACAAGCACTCTCGACTCTGAGCTCTACAAAAC
 
. : . : . : . : . : . :
JMFS107C12- AGCCAGGGTATCTCCGAGCTCATTGAGGTATTATGGTCTCGGGTTAAAGAAAGGCATATA
                      ____________________________________________________________
consensus AGCCAGGGTATCTCCGAGCTCATTGAGGTATTATGGTCTCGGGTTAAAGAAAGGCATATA
 
. : . : . : . : . : . :
JMFS107C12- TAGTGTTGAGCTTCATTTTGCTGAGATACAAATGGACGATTCTCGGGACTCTTGGAAAGG
                      ____________________________________________________________
consensus TAGTGTTGAGCTTCATTTTGCTGAGATACAAATGGACGATTCTCGGGACTCTTGGAAAGG
 
. : . : . : . : . : . :
JMFS107C12- CCTTGGGAAGCGCATTTTCGACGTTTACATTCAGGTATGGCAAATTTTGAAGTAGTACAT
                      ____________________________________________________________
consensus CCTTGGGAAGCGCATTTTCGACGTTTACATTCAGGTATGGCAAATTTTGAAGTAGTACAT
 
. : . : . : . : . : . :
JMFS107C12- TAGTACCATTACTCCATTAGCTGTTTTGTATATATGATCTACTTTCGTATTATTTGAACT
                      ____________________________________________________________
consensus TAGTACCATTACTCCATTAGCTGTTTTGTATATATGATCTACTTTCGTATTATTTGAACT
 
. : . : . : . : . : . :
JMFS107C12- GAAGGGGGAAAGAGTTCTTCGAGATTTCAATGTTAAAGACGAGGCCGGGGGGTCTAAAAA
rJMSF046F02+ GAAAGAGTTCTTCGAGATTTCAACGTTAAACAAGAGGCCGGGGGATCTAAGCG
                      ____________________________________________________________
consensus GAAGGGGGAAAGAGTTCTTCGAGATTTCAATGTTAAAGACGAGGCCGGGGGGTCTAAGCG
 
. : . : . : . : . : . :
JMFS107C12- GGCGTTGGTGAAGACATTCAAGGCGAACGTGACAAACAACGTGTTGGACATTCACTTCTT
rJMSF046F02+ GGCACTAGTGAAGAAGTTCAAGGCGAACGTGACAAACAACGTGTTGGACATTCACTTTTT
                      ____________________________________________________________
consensus GGCGTTGGTGAAGACGTTCAAGGCGAACGTGACAAACAACGTGTTGGACATTCACTTTTT
 
. : . : . : . : . : . :
JMFS107C12- CTGGGCCGGGAAGGGCACTTGCTGCATTCC
rJMSF046F02+ CTGGGCTGGGAAGGGCACCTGCTGCATTCCAGTCCAAAGCACATTTGGCCCTATAGTTTC
                      ____________________________________________________________
consensus CTGGGCTGGGAAGGGCACTTGCTGCATTCCAGTCCAAAGCACATTTGGCCCTATAGTTTC
 
. : . : . : . : . : . :
rJMSF046F02+ AGCCATCCATGTTGTTCAAGGTTCTTGAAACCGCGCCTCTTTCGATAAATAGATGCTCGG
                      ____________________________________________________________
consensus AGCCATCCATGTTGTTCAAGGTTCTTGAAACCGCGCCTCTTTCGATAAATAGATGCTCGG
 
. : . : . : . : . : . :
rJMSF046F02+ ATTCACTATTCACTACCTGAATGTGCGCTTTAACTCAATTTTGCAGAGGTCAATTTAGAT
                      ____________________________________________________________
consensus ATTCACTATTCACTACCTGAATGTGCGCTTTAACTCAATTTTGCAGAGGTCAATTTAGAT
 
. : . : . : . : . : . :
rJMSF046F02+ GATTCTTCAGACGGTAGTGACAAGAAACGCGTCGGAAAGATTATTGGAATCACGCTTGGA
                      ____________________________________________________________
consensus GATTCTTCAGACGGTAGTGACAAGAAACGCGTCGGAAAGATTATTGGAATCACGCTTGGA
 
. : . : . : . : . : . :
rJMSF046F02+ TCTGCAGCAGGAGTGCTCATAATTTGTTCCATTTTCTATGTGTGGTGGACAAAGAAAAAA
                      ____________________________________________________________
consensus TCTGCAGCAGGAGTGCTCATAATTTGTTCCATTTTCTATGTGTGGTGGACAAAGAAAAAA
 
. : . : . : . : . : . :
rJMSF046F02+ TCTCCAACCTACAAGGGATTCTAACTTGATTCAACAACAAAACTTCCTTCTTCTTCCAAA
                      ____________________________________________________________
consensus TCTCCAACCTACAAGGGATTCTAACTTGATTCAACAACAAAACTTCCTTCTTCTTCCAAA
 
. : . : . : . : . : . :
rJMSF046F02+ TACTGCCTACTGAACCAGTGAGCTAAGCTCGTGTCCGCACCTTCTTCCTAAGCCTATATA
                      ____________________________________________________________
consensus TACTGCCTACTGAACCAGTGAGCTAAGCTCGTGTCCGCACCTTCTTCCTAAGCCTATATA
 
. : . : . : . : . : . :
rJMSF046F02+ TGTAACCTCTCTCAGATCTTTAATTAATTAGGCCATGAATTGAAAGACCCTTACTCTTCT
                      ____________________________________________________________
consensus TGTAACCTCTCTCAGATCTTTAATTAATTAGGCCATGAATTGAAAGACCCTTACTCTTCT
 
. : . : . : . : . : . :
rJMSF046F02+ TTCTATCATAATGTATATTAATTGCATATAAATTAGCCCAACTAAGTGTGTAAGCTGTAA
                      ____________________________________________________________
consensus TTCTATCATAATGTATATTAATTGCATATAAATTAGCCCAACTAAGTGTGTAAGCTGTAA