Previous Contig 013641:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF031B15Sequence611006713 (2)gb:AY080787_15684906e-48Arabidopsis thaliana putative enoyl-CoA hydratase (At4g31810) mRNA, complete cds716013641 (2)gb:AY080787_15684908e-72Arabidopsis thaliana putative enoyl-CoA hydratase (At4g31810) mRNA, complete cds
JMSF046D01Sequence452006713 (2)gb:AY080787_15684903e-26Arabidopsis thaliana putative enoyl-CoA hydratase (At4g31810) mRNA, complete cds817013641 (2)gb:AY080787_15684901e-88Arabidopsis thaliana putative enoyl-CoA hydratase (At4g31810) mRNA, complete cds

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF046D01+ TTCCNGGCTACTTAGGTGAATATTTGGCTTTAACGGG
                      ____________________________________________________________
consensus TTCCNGGCTACTTAGGTGAATATTTGGCTTTAACGGG
 
. : . : . : . : . : . :
rJMSF031B15+ TATGTATTAAA
rJMSF046D01+ AGAAAAGCTTAACGGTGTAGAAATGATTGCCTGCGGTCTTGCAACACACTATGTATTAAA
                      ____________________________________________________________
consensus AGAAAAGCTTAACGGTGTAGAAATGATTGCCTGCGGTCTTGCAACACACTATGTATTAAA
 
. : . : . : . : . : . :
rJMSF031B15+ AGAAAGGCTTCCCTGGATTGAAGAACGGCTTGGTAAATTGATGACAGACGATCGTTCTGT
rJMSF046D01+ AGAAAGGCTTCCCTGGATTGAAGAACGGCTTGGTAAATTGATGACAGACGATCGTTCTGT
                      ____________________________________________________________
consensus AGAAAGGCTTCCCTGGATTGAAGAACGGCTTGGTAAATTGATGACAGACGATCGTTCTGT
 
. : . : . : . : . : . :
rJMSF031B15+ TATTGAAAATTCTCTTGCTCAATATGGGGACCTTGTTTATCCAGATAGGAGAAGCGTGCT
rJMSF046D01+ TATTGAAAATTCTCTTGCTCAATATGGGGACCTTGTTTATCCAGATAGGAGAAGCGTGCT
                      ____________________________________________________________
consensus TATTGAAAATTCTCTTGCTCAATATGGGGACCTTGTTTATCCAGATAGGAGAAGCGTGCT
 
. : . : . : . : . : . :
rJMSF031B15+ TCACAAGTTTGAAATGATTGATAAATGCTTTAGTCCAGACACGGTTGAGGAAATTATTGA
rJMSF046D01+ TCACAAGTTTGAAATGATTGATAAATGCTTTAGTCCAGACACGGTTGAGGAAATTATTGA
                      ____________________________________________________________
consensus TCACAAGTTTGAAATGATTGATAAATGCTTTAGTCCAGACACGGTTGAGGAAATTATTGA
 
. : . : . : . : . : . :
rJMSF031B15+ AGCTCTGGAAAACGAGACAACTGAGTCATACGATGAATGGTGTGCTACAACTCTTAAAAA
rJMSF046D01+ AGCTCTGGAAAACGAGACAACTGAGTCATACGATGAATGGTGTGCTACAACTCTTAAAAA
                      ____________________________________________________________
consensus AGCTCTGGAAAACGAGACAACTGAGTCATACGATGAATGGTGTGCTACAACTCTTAAAAA
 
. : . : . : . : . : . :
rJMSF031B15+ GATAAAAGCAGCATCTCCGTTAAGCTTGAAAGTCACTTTGAATTCAATTAGAGAAGGGAG
rJMSF046D01+ GATAAAAGCAGCATCTCCGTTAAGCTTGAAAGTCACTTTGAATTCAATTAGAGAAGGGAG
                      ____________________________________________________________
consensus GATAAAAGCAGCATCTCCGTTAAGCTTGAAAGTCACTTTGAATTCAATTAGAGAAGGGAG
 
. : . : . : . : . : . :
rJMSF031B15+ ATTTCAATCACTTGATCAGTGCCTGGCACGTGAATATCGCGTATCCCTGAACTGGATTTC
rJMSF046D01+ ATTTCAATCACTTGATCAGTGCCTGGCACGTGAATATCGCGTATCCCTGAACTGGATTTC
                      ____________________________________________________________
consensus ATTTCAATCACTTGATCAGTGCCTGGCACGTGAATATCGCGTATCCCTGAACTGGATTTC
 
. : . : . : . : . : . :
rJMSF031B15+ GAAACAGGTGTCTGGTGATTTCTGTGAGGGGGTTCGTGCTAGATTGATCGACAAGGATTT
rJMSF046D01+ GAAACAGGTGTCTGGTGATTTCTGTGAGGGGGTTCGTGCTAGATTGATCGACAAGGATTT
                      ____________________________________________________________
consensus GAAACAGGTGTCTGGTGATTTCTGTGAGGGGGTTCGTGCTAGATTGATCGACAAGGATTT
 
. : . : . : . : . : . :
rJMSF031B15+ CAGTCCAAAGTGGGATCCACCACGATTGGAGGACGTTACGAAGGACATGGTTGAATCCTT
rJMSF046D01+ CAGTCCAAAGTGGGATCCACCACGATTGGAGGACGTTACGAAGGACATGGTTGAATCCTT
                      ____________________________________________________________
consensus CAGTCCAAAGTGGGATCCACCACGATTGGAGGACGTTACGAAGGACATGGTTGAATCCTT
 
. : . : . : . : . : . :
rJMSF031B15+ CTTTGCCCCTCTGGGTGAGTTTGATTCGGAACTAAACTTGCCAACATCAATACGAGAGCC
rJMSF046D01+ CTTTGCCCCTCTGGGTGAGTTTGATTCGGAACTAAACTTGCCAACATCAATACGAGAGCC
                      ____________________________________________________________
consensus CTTTGCCCCTCTGGGTGAGTTTGATTCGGAACTAAACTTGCCAACATCAATACGAGAGCC
 
. : . : . : . : . : . :
rJMSF031B15+ TTCAGTTTGATCTCTGTTTCCGACTACAATTTCTGTAAAATTTTCAAACTACAGTTTTAG
rJMSF046D01+ TTCAGTTTGATCTCTGTTTCCGACTACAATTTCTGTAAAATTTTCAAACTACAGTTTTAG
                      ____________________________________________________________
consensus TTCAGTTTGATCTCTGTTTCCGACTACAATTTCTGTAAAATTTTCAAACTACAGTTTTAG
 
. : . : . : . : . : . :
rJMSF031B15+ ATTTGATAGGAAGGCAAGAAACAATAGCTTTTTGACCCACCCAACAGGCCAACACCATTA
rJMSF046D01+ ATTTGATAGGAAGGCAAGAAACAATAGCTTTTTGACCCACCCAACAGGCCAACACCATTA
                      ____________________________________________________________
consensus ATTTGATAGGAAGGCAAGAAACAATAGCTTTTTGACCCACCCAACAGGCCAACACCATTA
 
. : . : . : . : . : . :
rJMSF031B15+ AAGATTGAGTTTTATTGGTCATAAATTGGAGAGGAAAGATACACT
rJMSF046D01+ AAGATTGAGTTTTATTGGTCATAAATTGGAGAGGAAAGATACACTTTTAGTTATTTATAA
                      ____________________________________________________________
consensus AAGATTGAGTTTTATTGGTCATAAATTGGAGAGGAAAGATACACTTTTAGTTATTTATAA