Previous Contig 013636:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF046A20Sequence698013636 (2)gb:OSJN00052_16939493e-33Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0067K08, complete seque696013636 (2)gb:AB018118_15138849e-23Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRI1.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046A20- GGCAGCCGAGACAATGGATCTTGAAGC
                      ____________________________________________________________
consensus GGCAGCCGAGACAATGGATCTTGAAGC
 
. : . : . : . : . : . :
JMSF046A20- AAAGGCAACACTTTCACAAGCACACCCCGAGACAATGGACTTCCTTTCGCACGCCTGGTG
                      ____________________________________________________________
consensus AAAGGCAACACTTTCACAAGCACACCCCGAGACAATGGACTTCCTTTCGCACGCCTGGTG
 
. : . : . : . : . : . :
JMSF046A20- CGACTTTGCGGTTCAAGCCTTCCAGCCCGAAATGCAAGATCTCGCGCTAACTGTCCATGA
                      ____________________________________________________________
consensus CGACTTTGCGGTTCAAGCCTTCCAGCCCGAAATGCAAGATCTCGCGCTAACTGTCCATGA
 
. : . : . : . : . : . :
JMSF046A20- TAGCTCAATCAAGAAATTCAGTGATGACAGCAAGAAGCTGCCTTCTTTGCAGAAAATGGA
                      ____________________________________________________________
consensus TAGCTCAATCAAGAAATTCAGTGATGACAGCAAGAAGCTGCCTTCTTTGCAGAAAATGGA
 
. : . : . : . : . : . :
JMSF046A20- TAAAAGCATGAAGATGGATGATACAGATAAGTCTATACCTCCATGGACATCCAATGATGT
                      ____________________________________________________________
consensus TAAAAGCATGAAGATGGATGATACAGATAAGTCTATACCTCCATGGACATCCAATGATGT
 
. : . : . : . : . : . :
JMSF046A20- GAAGTCATGGATATGGATGCAACAAGCAATGCATCCCGAATTGAATTACCACAGCTATCT
                      ____________________________________________________________
consensus GAAGTCATGGATATGGATGCAACAAGCAATGCATCCCGAATTGAATTACCACAGCTATCT
 
. : . : . : . : . : . :
JMSF046A20- TAGAAAGAAATGGATTCCATGGAAGATAGCGCCACTAAAGAATTTCTCAATCAAGAAATG
                      ____________________________________________________________
consensus TAGAAAGAAATGGATTCCATGGAAGATAGCGCCACTAAAGAATTTCTCAATCAAGAAATG
 
. : . : . : . : . : . :
JMSF046A20- GCTTAAAGAAATGAAGCAGAAGAGGAAAGAAGAGAACAGATTACAAAAGGCGGAAGTGCA
                      ____________________________________________________________
consensus GCTTAAAGAAATGAAGCAGAAGAGGAAAGAAGAGAACAGATTACAAAAGGCGGAAGTGCA
 
. : . : . : . : . : . :
JMSF046A20- CGCAGCCATATCGGTTGCAGGGGTTGCAGCTGCACTAGCAGCCATAGCAGCAGAAAACTC
                      ____________________________________________________________
consensus CGCAGCCATATCGGTTGCAGGGGTTGCAGCTGCACTAGCAGCCATAGCAGCAGAAAACTC
 
. : . : . : . : . : . :
JMSF046A20- GAGCCGGGATGACAGTAAGGAGTCAGCTGTGGCATCTGCAGCTGCATTAGTCGCCGCCCA
                      ____________________________________________________________
consensus GAGCCGGGATGACAGTAAGGAGTCAGCTGTGGCATCTGCAGCTGCATTAGTCGCCGCCCA
 
. : . : . : . : . : . :
JMSF046A20- GTGTGCTAAAGTGGCGGAAGCCATGGGAGCAAAGAAGGACCAACTCAGCAGCGTAATTGG
rJMSF046A20+ GGGAGCAAAGAAGGACCAACTCAGCAGCGTAATTGG
                      ____________________________________________________________
consensus GTGTGCTAAAGTGGCGGAAGCCATGGGAGCAAAGAAGGACCAACTCAGCAGCGTAATTGG
 
. : . : . : . : . : . :
JMSF046A20- TTCGGCCATGAGTGGCACGAGCGCGAGCGACATTGTTACACTCACAGCTGCAGCCACAAC
rJMSF046A20+ TTCGGCCATGAGTGGCACGAGCGCGAGCGACATTGTTACACTCACAGCTGCAGCCACAAC
                      ____________________________________________________________
consensus TTCGGCCATGAGTGGCACGAGCGCGAGCGACATTGTTACACTCACAGCTGCAGCCACAAC
 
. : . : . : . : . : . :
JMSF046A20- ATCACTAAGAG
rJMSF046A20+ ATCACTAAGAGGAGCAGCAACACTTAAAGCGAGAAGAGAGTGTAAGGGTATACTAAATGG
                      ____________________________________________________________
consensus ATCACTAAGAGGAGCAGCAACACTTAAAGCGAGAAGAGAGTGTAAGGGTATACTAAATGG
 
. : . : . : . : . : . :
rJMSF046A20+ AAGTACACCAGTTCTCCCCATAGAAGATGGCAAGGATTTCGAGATCGAGTATGAATCATG
                      ____________________________________________________________
consensus AAGTACACCAGTTCTCCCCATAGAAGATGGCAAGGATTTCGAGATCGAGTATGAATCATG
 
. : . : . : . : . : . :
rJMSF046A20+ TAGATCAGTGCTTTCAAAGGGNGCAGAGCTCAACCTTGAAACATCAGATGGGAGATACAT
                      ____________________________________________________________
consensus TAGATCAGTGCTTTCAAAGGGNGCAGAGCTCAACCTTGAAACATCAGATGGGAGATACAT
 
. : . : . : . : . : . :
rJMSF046A20+ GCTAAGGTCAGTGTCCATCATCTTTAACCCTGAAGCCAAGGTTATTCTCAGGACAAGGAA
                      ____________________________________________________________
consensus GCTAAGGTCAGTGTCCATCATCTTTAACCCTGAAGCCAAGGTTATTCTCAGGACAAGGAA
 
. : . : . : . : . : . :
rJMSF046A20+ GCTTAATATATTGAATTCATTCCCNGGACNCAAAGAAAGTATCATAGTAGATCTGCNCGC
                      ____________________________________________________________
consensus GCTTAATATATTGAATTCATTCCCNGGACNCAAAGAAAGTATCATAGTAGATCTGCNCGC
 
. : . : . : . : . : . :
rJMSF046A20+ AGAGTTGTACAAGGATTGTGAAGGNGAGGAAATGGATAGTTGCTATCTAATTGTATTAAC
                      ____________________________________________________________
consensus AGAGTTGTACAAGGATTGTGAAGGNGAGGAAATGGATAGTTGCTATCTAATTGTATTAAC
 
. : . : . : . : . : . :
rJMSF046A20+ TACAAACAAGGGAATAATGAAGATAGACNTGATGGATGATTATGAACGTTATAGAATGTG
                      ____________________________________________________________
consensus TACAAACAAGGGAATAATGAAGATAGACNTGATGGATGATTATGAACGTTATAGAATGTG
 
. : . : . : . : . : . :
rJMSF046A20+ GTCAAAGACTNTTAAACNCATGTTGACNCTTTCTACTTCATTGACAACATATATGAGCTC
                      ____________________________________________________________
consensus GTCAAAGACTNTTAAACNCATGTTGACNCTTTCTACTTCATTGACAACATATATGAGCTC
 
. : . : . : . : . : . :
rJMSF046A20+ CAATTTTACAAAAGTTGAATTGAAGTCTACCNTTGTTGAGTGATGAGAATATTTGTATTC
                      ____________________________________________________________
consensus CAATTTTACAAAAGTTGAATTGAAGTCTACCNTTGTTGAGTGATGAGAATATTTGTATTC
 
. : . : . : . : . : . :
rJMSF046A20+ TGTGTTTTTTTTTTTAATAAATTTATAGCAAATATTTATATCGAGTTACAACCAATATTT
                      ____________________________________________________________
consensus TGTGTTTTTTTTTTTAATAAATTTATAGCAAATATTTATATCGAGTTACAACCAATATTT