Previous Contig 013628:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001M06Sequence418004881 (8)gb:AY056191_15635157e-53Arabidopsis thaliana putative oligosaccharyl transferase STT3 (At5g19690) mRNA, 664013628 (7)gb:AY056191_15635152e-59Arabidopsis thaliana putative oligosaccharyl transferase STT3 (At5g19690) mRNA,
JMSF004K05Sequence391004881 (8)gb:AY056191_15635152e-48Arabidopsis thaliana putative oligosaccharyl transferase STT3 (At5g19690) mRNA, 481013628 (7)gb:AY056191_15635151e-28Arabidopsis thaliana putative oligosaccharyl transferase STT3 (At5g19690) mRNA,
JMSF007G06Sequence392004881 (8)gb:AY056191_15635157e-44Arabidopsis thaliana putative oligosaccharyl transferase STT3 (At5g19690) mRNA, 757013628 (7)gb:AY056191_15635152e-77Arabidopsis thaliana putative oligosaccharyl transferase STT3 (At5g19690) mRNA,
JMSF029C19Sequence702004881 (8)gb:AY056191_1563515e-100Arabidopsis thaliana putative oligosaccharyl transferase STT3 (At5g19690) mRNA, 775013628 (7)gb:AY056191_15635151e-79Arabidopsis thaliana putative oligosaccharyl transferase STT3 (At5g19690) mRNA,
JMSF032K05Sequence603004881 (8)gb:AY056191_15635154e-73Arabidopsis thaliana putative oligosaccharyl transferase STT3 (At5g19690) mRNA, 650013628 (7)gb:AY056191_15635151e-55Arabidopsis thaliana putative oligosaccharyl transferase STT3 (At5g19690) mRNA,
JMSF037J14Sequence639004881 (8)gb:AY056191_15635151e-87Arabidopsis thaliana putative oligosaccharyl transferase STT3 (At5g19690) mRNA, 725013628 (7)gb:AY056191_15635152e-63Arabidopsis thaliana putative oligosaccharyl transferase STT3 (At5g19690) mRNA,
JMSF045N15Sequence758004881 (8)gb:AY056191_1563515e-108Arabidopsis thaliana putative oligosaccharyl transferase STT3 (At5g19690) mRNA, 751013628 (7)gb:AY056191_15635154e-67Arabidopsis thaliana putative oligosaccharyl transferase STT3 (At5g19690) mRNA,

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF029C19+ ATCAAACCACTGCCATGGCAAATCGCACTGTTATTGTTGACAATAACACCTGGA
                      ____________________________________________________________
consensus ATCAAACCACTGCCATGGCAAATCGCACTGTTATTGTTGACAATAACACCTGGA
 
. : . : . : . : . : . :
rJMSF029C19+ ACAACACACACATTGCTACTGTGGGAACAGCCATGTCATCACCTG--AAAAGGCAGCATG
rJMSF007G06+ ACACACACATTGCTACTGTGGGAACAGCCATGTCATCACCTG--AAAAGGCAGCATG
rJMSF037J14+ GGCAGCATG
rJMSF045N15+ AGCCATGTCATCACCTGNAAAAGGGCAGCATG
                      ____________________________________________________________
consensus ACAACACACACATTGCTACTGTGGGAACAGCCATGTCATCACCTG--AAAAGGCAGCATG
 
. : . : . : . : . : . :
rJMSF032K05+ GTCTTTGGATGTCAAATATGTTCTTGTTGTATTTGGAGGCCTTGTTG
rJMSF029C19+ GGATATA-TTCCAGTCTTTGGATGTCAAATATGTTCTTGTTGTATTTGGAGGCCTTGTTG
rJMSF007G06+ GGATATA-TTCCAGTCTTTGGATGTCAAATATATTCTTGTTGTATTTGGAGGCCTTGTTG
rJMSF037J14+ GGATATA-TTCCAGTCTTTGGATGTCAAATATGTTCTTGTTGTATTNGGAGGCCTTGTTG
rJMSF001M06+ GTATTTGGAGGCCTTGTTG
rJMSF045N15+ GGATATATTTCCAGTCTTTGGATGTCAAATATGTTCTTGNTGTATTTGGAGGCCTTGTTG
                      ____________________________________________________________
consensus GGATATA-TTCCAGTCTTTGGATGTCAAATATGTTCTTGTTGTATTTGGAGGCCTTGTTG
 
. : . : . : . : . : . :
rJMSF032K05+ GGTACCCCAGTGATGATATCAACAAGTTCCTATGGATGGTTCGAATTGGAGGAGGGGTAT
rJMSF029C19+ GGTACCCCAGTGATGATATCAACAAGTTCCTATGGATGGTTCGAATTGGAGGAGGGGTAT
rJMSF007G06+ GGTACCCCAGTGATGATATCAACAAGTTCCTATGGATGGTTCGAATTGGAGGAGGGGTAT
rJMSF037J14+ GGTACCCCAGTGATGATATCAACAAGTTCCTATGGATGGTTCGAATTGGAGGAGGGGTAT
rJMSF001M06+ GGTACCCCAGTGATGATATCAACAAGTTCCTATGGATGGTTCGAATTGGAGGAGGGGTAT
rJMSF045N15+ GGTACCCCAGTGATGATATCAACAAGTTCCTATGGATGGTTCGAATTGGAGGAGGGGTAT
                      ____________________________________________________________
consensus GGTACCCCAGTGATGATATCAACAAGTTCCTATGGATGGTTCGAATTGGAGGAGGGGTAT
 
. : . : . : . : . : . :
rJMSF032K05+ TTCCTCACATCAAGGAACCTGATTATCTGAGGGATGGTCAGTACCGCATTGATTCTCAAG
rJMSF029C19+ TTCCTCACATCAAGGAACCTGATTATCTGAGGGATGGTCAGTACCGCATTGATTCTCAAG
rJMSF007G06+ TTCCTCACATCAAGGAACCTGATTATCTGAGGGATGGTCAGTACCGCATTGATTCTCAAG
rJMSF037J14+ TTCCTCACATCAAGGAACCTGATTATCTGAGGGATGGTCAGTACCGCATTGATTCTCAAG
rJMSF001M06+ TTCCTCACATCAAGGAACCTGATTATCTGAGGGATGGTCAGTACCGCATTGATTCTCAAG
rJMSF045N15+ TTCCTCACATCAAGGAACCTGATTATCTGAGGGATGGTCAGTACCGCATTGATTCTCAAG
                      ____________________________________________________________
consensus TTCCTCACATCAAGGAACCTGATTATCTGAGGGATGGTCAGTACCGCATTGATTCTCAAG
 
. : . : . : . : . : . :
rJMSF032K05+ CCACTCCAACTATGCTAAACTCTCTCATGTACAAGCTGTCATATTACAGATTTGTGGAGA
rJMSF029C19+ CCACTCCAACTATGCTAAACTCTCTCATGTACAAGCTGTCATATTACAGATTTGTGGAGA
rJMSF004K05+ CTCTCTCATGTACAAGCTGTCATATTACAGATTTGTGGAGA
rJMSF007G06+ CCACTCCAACTATGCTAAACTCTCTCATGTACAAGCTGTCATATTACAGATTTGTGGAGA
rJMSF037J14+ CCACTCCAACTATGCTAAACTCTCTCATGTACAAGCTGTCATATTACAGATTTGTGGAGA
rJMSF001M06+ CCACTCCAACTATGCTAAACTCTCTCATGTACAAGCTGTCATATTACAGATTTGTGGAGA
rJMSF045N15+ CCACTCCAACTATGCTAAACTCTCTCATGTACAAGCTGTCATATTACAGATTTGTGGAGA
                      ____________________________________________________________
consensus CCACTCCAACTATGCTAAACTCTCTCATGTACAAGCTGTCATATTACAGATTTGTGGAGA
 
. : . : . : . : . : . :
rJMSF032K05+ CAGATGGCGGCAAGGGTTTTGATAGAGTTAGGCGGACTGAAATTGGAAAGAAAGTTTTTA
rJMSF029C19+ CAGATGGCGGCAAGGGTTTTGATAGAGTTAGGCGGACTGAAATTGGAAAGAAAGTTTTTA
rJMSF004K05+ CAGATGGCGGCAAGGGTTTTGATAGAGTTAGGCGGACTGAAATTGGAAAGAAAGTTTTTA
rJMSF007G06+ CAGATGGCGGCAAGGGTTTTGATAGAGTTAGGCGGACTGAAATTGGAAAGAAAGTTTTTA
rJMSF037J14+ CAGATGGCGGCAAGGGTTTTGATAGAGTTAGGCGGACTGAAATTGGAAAGAAAGTTTTTA
rJMSF001M06+ CAGATGGCGGCAAGGGTTTTGATAGAGTTAGGCGGACTGAAATTGGAAAGAAAGTTTTTA
rJMSF045N15+ CAGATGGCGGCAAGGGTTTTGATAGAGTTAGGCGGACTGAAATTGGAAAGAAAGTTTTTA
                      ____________________________________________________________
consensus CAGATGGCGGCAAGGGTTTTGATAGAGTTAGGCGGACTGAAATTGGAAAGAAAGTTTTTA
 
. : . : . : . : . : . :
rJMSF032K05+ AGCTCACTCACTTTGAGGAGGTATTCACCACACACCATTGGATGGTCCGGATATACAAAC
rJMSF029C19+ AGCTCACTCACTTTGAGGAGGTATTCACCACACACCATTGGATGGTCCGGATATACAAAC
rJMSF004K05+ AGCTCACTCACTTTGAGGAGGTATTCACCACACACCATTGGATGGTCCGGATATACAAAC
rJMSF007G06+ AGCTCACTCACTTTGAGGAGGTATTCACCACACACCATTGGATGGTCCGGATATACAAAC
rJMSF037J14+ AGCTCACTCACTTTGAGGAGGTATTCACCACACACCATTGGATGGTCCGGATATACAAAC
rJMSF001M06+ AGCTCACTCACTTTGAGGAGGTATTCACCACACACCANTGGATGGTCCGGATATACAAAC
rJMSF045N15+ AGCTCACTCACTTTGAGGAGGTATTCACCACACACCATTGGATGGTCCGGATATACAAAC
                      ____________________________________________________________
consensus AGCTCACTCACTTTGAGGAGGTATTCACCACACACCATTGGATGGTCCGGATATACAAAC
 
. : . : . : . : . : . :
rJMSF032K05+ TAAAGCCCCCAAAGAACAGGATCCGTGGGAAAACAAAGAAATCTAAGTCGGTGAAGTCTA
rJMSF029C19+ TAAAGCCCCCAAAGAACAGGATCCGTGGGAAAACAAAGAAATCTAAGTCGGTGAAGTCTA
rJMSF004K05+ TAAAGCCCCCAAAGAACAGGATCCGTGGGAAAACAAAGAAATCTAAGTCGGTGAAGTCTA
rJMSF007G06+ TAAAGCCCCCAAAGAACAGGATCCGTGGGAAAACAAAGAAATCTAAGTCGGTGAAGTCTA
rJMSF037J14+ TAAAGCCCCCAAAGAACAGGATCCGTGGGAAAACAAAGAAATCTAAGTCGGTGAAGTCTA
rJMSF001M06+ TAAAGCCCCCAAAGAACAGGATCCGTGGGAAAACAAAGAAATNTAAGTCGGTGAAGTCTA
rJMSF045N15+ TAAAGCCCCCAAAGAACAGGATCCGTGGGAAAACAAAGAAATCTAAGTCGGTGAAGTCTA
                      ____________________________________________________________
consensus TAAAGCCCCCAAAGAACAGGATCCGTGGGAAAACAAAGAAATCTAAGTCGGTGAAGTCTA
 
. : . : . : . : . : . :
rJMSF032K05+ GCAACTCAAAGAGAAGCGGAACAAGAAAGAAGAATCCATGGCACTAGAGAACATTACGAA
rJMSF029C19+ GCAACTCAAAGAGAAGCGGAACAAGAAAGAAGAATCCATGGCACTAGAGAACATTACGAA
rJMSF004K05+ GCAACTCAAAGAGAAGCGGAACAAGAAAGAAGAATCCATGGCACTAGAGAACATTACGAA
rJMSF007G06+ GCAACTCAAAGAGAAGCGGAACAAGAAAGAAGAATCCATGGCACTAGAGAACATTACGAA
rJMSF037J14+ GCAACTCAAAGAGAAGCGGAACAAGAAAGAAGAATCCATGGCACTAGAGAACATTACGAA
rJMSF001M06+ GCAACTCAAAGAGAAGCGGAACAAGAAAGAAGAATCCATGGCACTAGAGAACATTACGAA
rJMSF045N15+ GCAACTCAAAGAGAAGCGGAACAAGAAAGAAGAATCCATGGCACTAGAGAACATTACGAA
                      ____________________________________________________________
consensus GCAACTCAAAGAGAAGCGGAACAAGAAAGAAGAATCCATGGCACTAGAGAACATTACGAA
 
. : . : . : . : . : . :
rJMSF032K05+ CTTCTAGTAGAGGATGACTTTTGCAACACATGCTTTGTAGTTTCACATTCGAAGGAATCG
rJMSF029C19+ CTTCTAGTAGAGGATGACTTTTGCAACACATGCTTTGTAGTTTCACATTCGAAGGAATCG
rJMSF004K05+ CTTCTAGTAGAGGATGACTTTTGCAACACATGCTTTGTAGTTTCACATTCGAAGGAATCG
rJMSF007G06+ CTTCTAGTAGAGGATGACTTTTGCAACACATGCTTTGTAGTTTCACATTCGAAGGAATCG
rJMSF037J14+ CTTCTAGTAGAGGATGACTTTTGCAACACATGCTTTGTAGTTTCACATTCGAAGGAATCG
rJMSF001M06+ CTTCTAGTAGAGGATGACTTTTGCAACACATGCTTTGTAGTTTCACATTCGAAGGAATCG
rJMSF045N15+ CTTCTAGTAGAGGATGACTTTTGCAACACATGCTTTGTAGTTTCACATTCGAAGGAATCG
                      ____________________________________________________________
consensus CTTCTAGTAGAGGATGACTTTTGCAACACATGCTTTGTAGTTTCACATTCGAAGGAATCG
 
. : . : . : . : . : . :
rJMSF032K05+ AGCTTGAGATTATGCGGTGGTCTCAATGTTCTTTCTCTTTTCACTTACCATCCACGTAGA
rJMSF029C19+ AGCTTGAGATTATGCGGTGGTCTCAATGTTCTTTCTCTTTTCACTTACCATCCACGTAGA
rJMSF004K05+ AGCTTGAGATTATGCGGTGGTCTCAATGTTCTTTCTCTTTTCACTTACCATCCACGTAGA
rJMSF007G06+ AGCTTGAGATTATGCGGTGGTCTCAATGTTCTTTCTCTTTTCACTTACCATCCACGTAGA
rJMSF037J14+ AGCTTGAGATTATGCGGTGGTCTCAATGTTCTTTCTCTTTTCACTTACCATCCACGTAGA
rJMSF001M06+ AGCTTGAGATTATGCGGTGGTCTCAATGTTCTTTCTCTTTTCACTTACCATCCACGTAGA
rJMSF045N15+ AGCTTGAGATTATGCGGTGGTCTCAATGTTCTTTCTCTTTTCACTTACCATCCACGTAGA
                      ____________________________________________________________
consensus AGCTTGAGATTATGCGGTGGTCTCAATGTTCTTTCTCTTTTCACTTACCATCCACGTAGA
 
. : . : . : . : . : . :
rJMSF032K05+ GACTGCTGAAAGGATTGTTTTGATTAGCAATTCAGAGATTTTAGCTGAGTGTACTAAATC
rJMSF029C19+ GACTGCTGAAAGGATTGTTTTGATTAGCAATTCAGAGATTTTAGCTGAGTGTACTAAATC
rJMSF004K05+ GACTGCTGAAAGGATTGTTTTGATTAGCAATTCAGAGATTTTAGCTGAGTGTACTAAATC
rJMSF007G06+ GACTGCTGAAAGGATTGTTTTGATTAGCAATTCAGAGATTTTAGCTGAGTGTACTAAATC
rJMSF037J14+ GACTGCTGAAAGGATTGTTTTGATTAGCAATTCAGAGATTTTAGCTGAGTGTACTAAATC
rJMSF001M06+ GACTGCTGAAAGGACTTGTTTGATTAGCAATTCNGAGATTTTAGCNGAGTGTACTAAATC
rJMSF045N15+ GACTGCTGAAAGGATTGTTTTGATTAGCAATTCAGAGATTTTAGCTGAGTGTACTAAATC
                      ____________________________________________________________
consensus GACTGCTGAAAGGATTGTTTTGATTAGCAATTCAGAGATTTTAGCTGAGTGTACTAAATC
 
. : . : . : . : . : . :
rJMSF032K05+ GAA
rJMSF029C19+ GAAT
rJMSF004K05+ GAATGTATTTATATTGCTCA
rJMSF007G06+ GAATGTATTTATATTGCTCATAGACATA-CAGTTCAGTCAAAAT
rJMSF037J14+ GAATGTATTTATATTGCTCATAGACATACCAGTTCAGTCAAAATTTTCTGTG
rJMSF001M06+ GAATGTATTTATATTGCTCATAGACATA-CAGTTCAGTCAAAAT
rJMSF045N15+ GAATGTATTTATATTGCTCATAGACATA-CAGTTCAGTCAAAATTTTCTGTGCACCTTCA
                      ____________________________________________________________
consensus GAATGTATTTATATTGCTCATAGACATA-CAGTTCAGTCAAAATTTTCTGTGCACCTTCA