Previous Contig 013614:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008E09Sequence430004971 (2)gb:AE016959_10238302e-17Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC07785013614 (2)
JMSF045H23Sequence259004971 (2)628013614 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF008E09+ AATGTAAGA
                      ____________________________________________________________
consensus AATGTAAGA
 
. : . : . : . : . : . :
rJMSF008E09+ CTGTAAGTTATCTTTTCACATTGATCTCTGATTGACTTTTGATGTCTTGATTTTGTTGTG
                      ____________________________________________________________
consensus CTGTAAGTTATCTTTTCACATTGATCTCTGATTGACTTTTGATGTCTTGATTTTGTTGTG
 
. : . : . : . : . : . :
rJMSF008E09+ AAAGTGCTGTTGTTCTTTTCAGAATATAGACAAACTACAAGAAGTCGACAGCCCAGTTTT
                      ____________________________________________________________
consensus AAAGTGCTGTTGTTCTTTTCAGAATATAGACAAACTACAAGAAGTCGACAGCCCAGTTTT
 
. : . : . : . : . : . :
rJMSF008E09+ AATTATCCATGTAAGAAACATCTCTTTCCTCAATTTTATATATATTTTGTTACATTTGTG
rJMSF045H23+ ATTTTATATATATTTTGTTACATTTGTG
                      ____________________________________________________________
consensus AATTATCCATGTAAGAAACATCTCTTTCCTCAATTTTATATATATTTTGTTACATTTGTG
 
. : . : . : . : . : . :
rJMSF008E09+ ATGATTTTTTTCCTCGCTCCCTAGTTATTTACATATAGCCTGCCAAGAACACAATTAAAA
rJMSF045H23+ ATGATTTTTTTCCTCGCTCCCTAGTTATTTACATATAGCCTGCCAAGAACACAATTAAAA
                      ____________________________________________________________
consensus ATGATTTTTTTCCTCGCTCCCTAGTTATTTACATATAGCCTGCCAAGAACACAATTAAAA
 
. : . : . : . : . : . :
rJMSF008E09+ ACTACAAAAATCATGAAAGGAAAAGCATCACAACTTATGGTTTGAGTCATTTGACTAATA
rJMSF045H23+ ACTACAAAAATCATGAAAGGAAAAGCATCACAACTTATGGTTTGAGTCATTTGACTAATA
                      ____________________________________________________________
consensus ACTACAAAAATCATGAAAGGAAAAGCATCACAACTTATGGTTTGAGTCATTTGACTAATA
 
. : . : . : . : . : . :
rJMSF008E09+ GAGAGTAAATGAAATGGGAGATTTAGTAAACAGAGTTGGTGATAAAGGTAGGATTCTGGG
rJMSF045H23+ GAGAGTAAATGAAATGGGAGATTTAGTAAACAGAGTTGGTGATAAAGGTAGGATTCTGGG
                      ____________________________________________________________
consensus GAGAGTAAATGAAATGGGAGATTTAGTAAACAGAGTTGGTGATAAAGGTAGGATTCTGGG
 
. : . : . : . : . : . :
rJMSF008E09+ ATGGCAGTTGCTGCGATGTTACCTAACAACACCTGACGTTTTTGACCTATTGACTAGTGT
rJMSF045H23+ ATGGCAGTTGCTGCGATGTTACCTAACAACACCTGACGTTTTTGACCTATTGACTAGTGT
                      ____________________________________________________________
consensus ATGGCAGTTGCTGCGATGTTACCTAACAACACCTGACGTTTTTGACCTATTGACTAGTGT
 
. : . : . : . : . : . :
rJMSF008E09+ AAGGACAATGTAGTATCCAGTCATATGATCTTAGTTCTTGAGCCGATTCTTTACTGTCAA
rJMSF045H23+ AAGGACAATGTAGTATCCAGTCATATGATCTTAGTTCTTGAGCCGATTCTTTACTGTCAA
                      ____________________________________________________________
consensus AAGGACAATGTAGTATCCAGTCATATGATCTTAGTTCTTGAGCCGATTCTTTACTGTCAA
 
. : . : . : . : . : . :
rJMSF008E09+ GAAGAAGACATGTGCGGGTTACTAATTTGGATCAAGGTTGCTGAAGAAGAAAGCGAAGGT
rJMSF045H23+ GAAGAAGACATGTGCGGGTTACTAATTTGGATCAAGGTTGCTGAAGAAGAAAGCGAAGGT
                      ____________________________________________________________
consensus GAAGAAGACATGTGCGGGTTACTAATTTGGATCAAGGTTGCTGAAGAAGAAAGCGAAGGT
 
. : . : . : . : . : . :
rJMSF008E09+ TGTGAAAGCATCTTGATTCATTAGTCATCTCAGTTGTATGCCCCTCCAACTGCTAAATCG
rJMSF045H23+ TGTGAAAGCATCTTGATTCATTAGTCATCTCAGTTGTATGCCCCTCCAACTGCTAAATCG
                      ____________________________________________________________
consensus TGTGAAAGCATCTTGATTCATTAGTCATCTCAGTTGTATGCCCCTCCAACTGCTAAATCG
 
. : . : . : . : . : . :
rJMSF008E09+ ATTCGAAGACATTATAAGCAATGTTTGAGCTTTGTCTGAATGATTTAGTGCATTGGTTCT
rJMSF045H23+ ATTCGAAGACATTATAAGCAATGTTTGAGCTTTGTCTGAATGATTTAGTGCATTGGTTCT
                      ____________________________________________________________
consensus ATTCGAAGACATTATAAGCAATGTTTGAGCTTTGTCTGAATGATTTAGTGCATTGGTTCT
 
. : . : . : . : . : . :
rJMSF008E09+ CATTATCCATCTTGATCAAGTGTACCAATTAAATGTAGGTAATATTATGTTGTATGATGT
rJMSF045H23+ CATTATCCATCTTGATCAAGTGTACCAATTAAATGTAGGTAATATTATGTTGTATGATGT
                      ____________________________________________________________
consensus CATTATCCATCTTGATCAAGTGTACCAATTAAATGTAGGTAATATTATGTTGTATGATGT
 
. : . : . : . : . : . :
rJMSF008E09+ GTCCCAATCCCCACAAATCTTTCTAGTTGTC
rJMSF045H23+ GTCCCAATCCCCACAAATCTTTCTAGTTGTCCTTTAANCTTTGGAAACTTTGTATACCAT
                      ____________________________________________________________
consensus GTCCCAATCCCCACAAATCTTTCTAGTTGTCCTTTAANCTTTGGAAACTTTGTATACCAT