Previous Contig 013613:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF044H13Sequence821007609 (2)pir|T49907|T499074e-34hypothetical protein T24H18.90 - Arabidopsis thaliana>gb:ATT24H18_1555420 Arabid707013613 (2)
JMSF045H13Sequence138007609 (2)664013613 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF044H13+ TTCAGATAACTCGCCCAGGAGGGAACAAACCCCAAACTCCTGCTTCTA
rJMSF045H13+ TCTA
                      ____________________________________________________________
consensus TTCAGATAACTCGCCCAGGAGGGAACAAACCCCAAACTCCTGCTTCTA
 
. : . : . : . : . : . :
rJMSF044H13+ ACAATTTGGAGGTTAGCAAAATTTCTGGAAGGGAAGAAGAGCAGAAACGGGGACAGGAGA
rJMSF045H13+ ACAATTGGGAGGTTAGCAAAATTTCTGGAAGGGANGAAGAGCAGAAACGGGGACAGGAGA
                      ____________________________________________________________
consensus ACAATTTGGAGGTTAGCAAAATTTCTGGAAGGGAAGAAGAGCAGAAACGGGGACAGGAGA
 
. : . : . : . : . : . :
rJMSF044H13+ AGAAACCGGCACCTGTGAAAGCAATCGACAGACATCATAGTTCCAGGCCAGTAAGCCCTT
rJMSF045H13+ AGAAACCGGCACCTGTGAAAGCAATCGACAGACATCATAGTTCCAGGCCAGTAAGCCCTT
                      ____________________________________________________________
consensus AGAAACCGGCACCTGTGAAAGCAATCGACAGACATCATAGTTCCAGGCCAGTAAGCCCTT
 
. : . : . : . : . : . :
rJMSF044H13+ CATTAAATCAGACAGGTAATTCTGTTTCCAGTTCAAGGAACAAGCCCCAAACTCCTGCAG
rJMSF045H13+ CATTAAATCAGACAGGTAATTCTGTTTCCAGTTCAAGGAACAAGCCCCAAACTCCTGCAG
                      ____________________________________________________________
consensus CATTAAATCAGACAGGTAATTCTGTTTCCAGTTCAAGGAACAAGCCCCAAACTCCTGCAG
 
. : . : . : . : . : . :
rJMSF044H13+ CTACCAAAAGTGCTGAAAGGGAAGGAGACCAGAAATGGGGACCGGAGAAGAATCCCGCAC
rJMSF045H13+ NTACCAAAAGTGCTGAAAGGGAAGGAGNCCAGAAATGGGGNCCGGAGAAGAATCCCGCAC
                      ____________________________________________________________
consensus CTACCAAAAGTGCTGAAAGGGAAGGAGACCAGAAATGGGGACCGGAGAAGAATCCCGCAC
 
. : . : . : . : . : . :
rJMSF044H13+ TTGTGAGACTAACAGACAGGTATTATAGCTCCAGGCCAGTAAGCCCTTTGAAGGAAATAT
rJMSF045H13+ TTGTGAGANTAACAGACAGGTATTATAGCTCCAGGCCAGTAAGCCCTTTGAAGGAAATAT
                      ____________________________________________________________
consensus TTGTGAGACTAACAGACAGGTATTATAGCTCCAGGCCAGTAAGCCCTTTGAAGGAAATAT
 
. : . : . : . : . : . :
rJMSF044H13+ CATCCAATCAGATAGGCAGTTCAGTTTCCAGTTCAAAATCAAAGCAAACACCTTCTGGAA
rJMSF045H13+ CATCCAATCAGATAGGCAGTTCAGTTTCCAGTTCAAAATCAAAGCAAACACCTTCTGGAA
                      ____________________________________________________________
consensus CATCCAATCAGATAGGCAGTTCAGTTTCCAGTTCAAAATCAAAGCAAACACCTTCTGGAA
 
. : . : . : . : . : . :
rJMSF044H13+ GAGAACCTACAAGTAGGGGCAAGCCTCCTGTTAGATCCAAGCTCGCGGATCAGCATAAGA
rJMSF045H13+ GAGAACCTACAAGTAGGGGCAAGCCTCCTGTTAGATCCAAGCTCGCGGATCAGCATAAGA
                      ____________________________________________________________
consensus GAGAACCTACAAGTAGGGGCAAGCCTCCTGTTAGATCCAAGCTCGCGGATCAGCATAAGA
 
. : . : . : . : . : . :
rJMSF044H13+ GATGGGTTTAAATTCCTTGAAGGGGTGAAGCATGAAGATCGATGCGATATTTTGAAGTGT
rJMSF045H13+ GATGGGTTTAAATTCCTTGAAGGGGTGAAGCATGAAGATCGATGCGATATTTTGAAGTGT
                      ____________________________________________________________
consensus GATGGGTTTAAATTCCTTGAAGGGGTGAAGCATGAAGATCGATGCGATATTTTGAAGTGT
 
. : . : . : . : . : . :
rJMSF044H13+ CATTGCATCTATGTTGAAGGTATTGCAGGTTGCTATGATGAAGATACTCAACTGTTATGT
rJMSF045H13+ CANTGCATCTATGTTGAAGGTATTGCAGGNTGCTATGATGAAGATACTCAACTGTTATGT
                      ____________________________________________________________
consensus CATTGCATCTATGTTGAAGGTATTGCAGGTTGCTATGATGAAGATACTCAACTGTTATGT
 
. : . : . : . : . : . :
rJMSF044H13+ AACATTGTAGCAGTTGTAACTATTAAGTGTTAGCAGGATAGTGTTCATATGTCTGTTAAA
rJMSF045H13+ AACATTGTAGCAGTTGTAACTATTAAGNGTTAGCAGGATAGTGTTCATANGTCTGTTAAA
                      ____________________________________________________________
consensus AACATTGTAGCAGTTGTAACTATTAAGTGTTAGCAGGATAGTGTTCATATGTCTGTTAAA
 
. : . : . : . : . : . :
rJMSF044H13+ TTTACTGAAATTATGCAAATATATCCAGTAATATCAGTTATTATTAGACTAAACTGAAT
rJMSF045H13+ TTTACTGAAATTATGCAAATATATCCAGTAATATCAGTTATTAATAGACTAAACTGAATT
                      ____________________________________________________________
consensus TTTACTGAAATTATGCAAATATATCCAGTAATATCAGTTATTATTAGACTAAACTGAATT