Previous Contig 013612:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF030L02Sequence641019630gb:AY037938_15601741e-81Ipomoea batatas soluble acid invertase Ib2FRUCT3 (Ibbfruct3) mRNA, complete cds.681013612 (2)gb:AY037938_15601743e-80Ipomoea batatas soluble acid invertase Ib2FRUCT3 (Ibbfruct3) mRNA, complete cds.
JMSF045H04Sequence707013612 (2)gb:AY037938_15601742e-71Ipomoea batatas soluble acid invertase Ib2FRUCT3 (Ibbfruct3) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF030L02+ CTACTCAGTTGGACATTAGCGCGTGGTTTGAAGTGGAGAATAGCAGCG
rJMSF045H04+ TACTCAGTTGGACATTAGCGCGTGGTTTGAAGTGGAGAATAGCAGCG
                      ____________________________________________________________
consensus CTACTCAGTTGGACATTAGCGCGTGGTTTGAAGTGGAGAATAGCAGCG
 
. : . : . : . : . : . :
rJMSF030L02+ TGGAAGTGGAAGTGGAAGCGGACGGCGGGTACAATTGCAGTAGCAGCGGCGGCGCTGTTA
rJMSF045H04+ TGGAAGTGGAAGTGGAAGCGGACGGCGGGTACAATTGCAGTAGCAGCGGCGGCGCTNTTA
                      ____________________________________________________________
consensus TGGAAGTGGAAGTGGAAGCGGACGGCGGGTACAATTGCAGTAGCAGCGGCGGCGCTGTTA
 
. : . : . : . : . : . :
rJMSF030L02+ GGCGAGGCGCTTTGGGGCCATTCGGAGTTGTAGTGATTGCAGACGAAACGCTTTCTGAGC
rJMSF045H04+ GGCGAGGCGCTTTGGGGCCATTCGGAGTTGTAGTGATTGCAGACGAAACGCTTTCTGAGC
                      ____________________________________________________________
consensus GGCGAGGCGCTTTGGGGCCATTCGGAGTTGTAGTGATTGCAGACGAAACGCTTTCTGAGC
 
. : . : . : . : . : . :
rJMSF030L02+ TCACGCCGGTGTACTTCTACATCTCAAAGGGCACCGACGGGAAATCACACACTCATTTCT
rJMSF045H04+ TCACGCCGGTGTACTTCTACATCTCAAAGGGCACCGACGGGNAATCACACACTCATTTCT
                      ____________________________________________________________
consensus TCACGCCGGTGTACTTCTACATCTCAAAGGGCACCGACGGGAAATCACACACTCATTTCT
 
. : . : . : . : . : . :
rJMSF030L02+ GCACTGACCAAACAAGATCGTCGGAGTCTTCCAGTGTTGGGAAAGACGTTTATGGAAGCA
rJMSF045H04+ GCNCTGACCAAACAAGATCGTCGGAGTCTTCCAGTGTTGGGAAAGACGTTTATGGAAGCA
                      ____________________________________________________________
consensus GCACTGACCAAACAAGATCGTCGGAGTCTTCCAGTGTTGGGAAAGACGTTTATGGAAGCA
 
. : . : . : . : . : . :
rJMSF030L02+ CGGTGCCTGTTCTTGAGGGTGAACCCTACACTACCAGAATATTGGTGGACCACTCGATCG
rJMSF045H04+ CGGTGCCTGTTCTTGAGGGTGAACCCTACACTNCCAGAATATTGGTGGACCACTCGATCG
                      ____________________________________________________________
consensus CGGTGCCTGTTCTTGAGGGTGAACCCTACACTACCAGAATATTGGTGGACCACTCGATCG
 
. : . : . : . : . : . :
rJMSF030L02+ TGGAGAGCTTTGCTCAAGGAGGGAGAACGGTGATAACATCAAGAATTTATCCAACGAAAG
rJMSF045H04+ TGGAGAGCTTTGCTCAAGGAGGGAGAACGGTGATAACATCAAGAATTTATCCAACGAAAG
                      ____________________________________________________________
consensus TGGAGAGCTTTGCTCAAGGAGGGAGAACGGTGATAACATCAAGAATTTATCCAACGAAAG
 
. : . : . : . : . : . :
rJMSF030L02+ CCATATACGGAGCTGCAAGGGTTTTCCTCTTCAACAACGCCACAGAGGCAAGCGTGAAGG
rJMSF045H04+ CCATATACGGAGCTGCAAGGGTTTTCNTCTTCAACAACGCCACAGAGGCAAGCGTGAAGG
                      ____________________________________________________________
consensus CCATATACGGAGCTGCAAGGGTTTTCCTCTTCAACAACGCCACAGAGGCAAGCGTGAAGG
 
. : . : . : . : . : . :
rJMSF030L02+ CGTCGGTGAAGATCTGGGAAATGGGATCAGCTGACATTAAACCATTCCCTTTCAGCAATG
rJMSF045H04+ CGTCGGTGAAGATCTGGGAAATGGGATCAGCTGACANTAAACCATTCCCTTTCAGCAATG
                      ____________________________________________________________
consensus CGTCGGTGAAGATCTGGGAAATGGGATCAGCTGACATTAAACCATTCCCTTTCAGCAATG
 
. : . : . : . : . : . :
rJMSF030L02+ AATTGTAATATATATATATATATATACTAATATGTGCACGTTAGTGCTGTTGTTGTTGTT
rJMSF045H04+ AATTGTAATATATATATATATATATNCTAATATGTGCACGTTAGTGCTGTTGTTGTTGTT
                      ____________________________________________________________
consensus AATTGTAATATATATATATATATATACTAATATGTGCACGTTAGTGCTGTTGTTGTTGTT
 
. : . : . : . : . : . :
rJMSF030L02+ GTACCTTTTTAGGTATTTGGCTTCGTCGCATAATATAATTTAATATGAAGAGATGGAACC
rJMSF045H04+ GTACCTTTTTAGGTATTNNGCTTCGTCGCATAATATAATTTAATANGAAGAGATGGAACC
                      ____________________________________________________________
consensus GTACCTTTTTAGGTATTTGGCTTCGTCGCATAATATAATTTAATATGAAGAGATGGAACC
 
. : . : . : . : . : . :
rJMSF030L02+ AGCGGTTTGTGCTCAACAAATGAAGAAAT
rJMSF045H04+ AGCGGTTTGTNCTCAACAAATGAAGAAATTGGGGTTACATAAGCAAGAATGTATAGAACT
                      ____________________________________________________________
consensus AGCGGTTTGTGCTCAACAAATGAAGAAATTGGGGTTACATAAGCAAGAATGTATAGAACT