Previous Contig 013605:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF025K05Sequence531006313 (3)gb:AY448010S4_16065891e-48Ipomoea trifida haplotype S1 self-incompatibility (S-) locus, contig SR4.750013605 (3)gb:AY448010S4_16065899e-86Ipomoea trifida haplotype S1 self-incompatibility (S-) locus, contig SR4.
JMSF038O04Sequence552006313 (3)gb:AY448010S4_16065892e-49Ipomoea trifida haplotype S1 self-incompatibility (S-) locus, contig SR4.911013605 (3)gb:AY448010S4_1606589e-112Ipomoea trifida haplotype S1 self-incompatibility (S-) locus, contig SR4.
JMSF045F10Sequence672006313 (3)gb:AY448010S4_16065893e-68Ipomoea trifida haplotype S1 self-incompatibility (S-) locus, contig SR4.840013605 (3)gb:AY448010S4_1606589e-102Ipomoea trifida haplotype S1 self-incompatibility (S-) locus, contig SR4.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF038O04+ CATGCGCCCATCGAT
                      ____________________________________________________________
consensus CATGCGCCCATCGAT
 
. : . : . : . : . : . :
rJMSF038O04+ TATGTCGAGAGTGCNTCTTAGCAAGTTGGAGAAGTTNTGCATCTGGTTTTTGTCCTGTTT
                      ____________________________________________________________
consensus TATGTCGAGAGTGCNTCTTAGCAAGTTGGAGAAGTTNTGCATCTGGTTTTTGTCCTGTTT
 
. : . : . : . : . : . :
rJMSF038O04+ GTAGAAAGACTGTCAGCAAGCAGGAACTGATCACAGCACCAACAGATAGCCGTTTCCAGA
rJMSF045F10+ AAAGACTGTCAGCAAGCAGGAACTGATCACAGCACCAACAGATAGCCGTTTCCAGA
                      ____________________________________________________________
consensus GTAGAAAGACTGTCAGCAAGCAGGAACTGATCACAGCACCAACAGATAGCCGTTTCCAGA
 
. : . : . : . : . : . :
rJMSF025K05+ GGAATCATCGAAAGTTACTGCATTGTTGCATGAACTAG
rJMSF038O04+ TAGATGTTGAAAAGAATTGGGTGGAATCATCGAAAGTTACTGCATTGTTGCATGAACTAG
rJMSF045F10+ TAGATGTTGAAAAGAATTGGGTGGAATCATCGAAAGTTACTGCATTGTTGCATGAACTAG
                      ____________________________________________________________
consensus TAGATGTTGAAAAGAATTGGGTGGAATCATCGAAAGTTACTGCATTGTTGCATGAACTAG
 
. : . : . : . : . : . :
rJMSF025K05+ AACAATTACGTGCTGTAAACTCCAAAAGCATTGTTTTTAGTCAGTGGACTGCCTTTTTGG
rJMSF038O04+ AACAATTACGTGCTGTAAACTCCAAAAGCATTGTTTTTAGTCAGTGGACTGCCTTTTTGG
rJMSF045F10+ AACAATTACGTGCTGTAAACTCCAAAAGCATTGTTTTTAGTCAGTGGACTGCCTTTTTGG
                      ____________________________________________________________
consensus AACAATTACGTGCTGTAAACTCCAAAAGCATTGTTTTTAGTCAGTGGACTGCCTTTTTGG
 
. : . : . : . : . : . :
rJMSF025K05+ ACCTCTTGCAAATTGCTCTTGCTCGGAATGATATCCCTTTTCTTCGCCTTGATGGGACTC
rJMSF038O04+ ACCTCTTGCAAATTGCTCTTGCTCGGAATGATATCCCTTTTCTTCGCCTTGATGGGACTC
rJMSF045F10+ ACCTCTTGCAAATTGCTCTTGCTCGGAATGATATCCCTTTTCTTCGCCTTGATGGGACTC
                      ____________________________________________________________
consensus ACCTCTTGCAAATTGCTCTTGCTCGGAATGATATCCCTTTTCTTCGCCTTGATGGGACTC
 
. : . : . : . : . : . :
rJMSF025K05+ TAAACCAGCAACAGCGTGAGAAAGTAATAAAAAAATTTTCAGAAGAAGATAGTGTTTTGG
rJMSF038O04+ TAAACCAGCAACAGCGTGAGAAAGTAATAAAAAAATTTTCAGAAGAAGATAGTGTTTTG-
rJMSF045F10+ TAAACCAGCAACAGCGTGAGAAAGTAATAAAAAAATTTTCAGAAGAAGATAGTGTTTTGG
                      ____________________________________________________________
consensus TAAACCAGCAACAGCGTGAGAAAGTAATAAAAAAATTTTCAGAAGAAGATAGTGTTTTGG
 
. : . : . : . : . : . :
rJMSF025K05+ TGTTGTTAATGTCATTGAAGGCTGGTGGTGTCGGAATAAACCTGACGGCAGCATCCAATG
rJMSF038O04+ -GTTGTTAATGTCATTGAAGGCTGGTGGTGTCGGAATAAACCTGACGGCAGCATCCAATG
rJMSF045F10+ TGTTGTTAATGTCATTGAAGGCTGGTGGTGTCGGAATAAACCTGACGGCAGCATCCAATG
                      ____________________________________________________________
consensus TGTTGTTAATGTCATTGAAGGCTGGTGGTGTCGGAATAAACCTGACGGCAGCATCCAATG
 
. : . : . : . : . : . :
rJMSF025K05+ CTTTTGTCTTGGATCCATGGTGGAATCCGGCTGTGGAGGAACAAGCTGTGATGCGTGTCC
rJMSF038O04+ CTTTTGTCTTGGATCCATGGTGGAATCCGGCTGTGGAGGAACAAGCTGTGATGCGTGTCC
rJMSF045F10+ CTTTTGTCTTGGATCCATGGTGGAATCCGGCTGTGGAGGAACAAGCTGTGATGCGTGTCC
                      ____________________________________________________________
consensus CTTTTGTCTTGGATCCATGGTGGAATCCGGCTGTGGAGGAACAAGCTGTGATGCGTGTCC
 
. : . : . : . : . : . :
rJMSF025K05+ ATCGTATTGGACAAACAAAAAGAGTTGCAATCAAACGGTTCATTGTGAAGGGAACAGTTG
rJMSF038O04+ ATCGTATTGGACAAACAAAAAGAGTTGCAATCAAACGGTTCATTGTGAAGGGAACAGTTG
rJMSF045F10+ ATCGTATTGGACAAACAAAAAGAGTTGCAATCAAACGGTTCATTGTGAAGGGAACAGTTG
                      ____________________________________________________________
consensus ATCGTATTGGACAAACAAAAAGAGTTGCAATCAAACGGTTCATTGTGAAGGGAACAGTTG
 
. : . : . : . : . : . :
rJMSF025K05+ AGGAGAGAATGGAGGCAGTGCAAGCCAGGAAACAGCGTATGATTTCTGGCGCCCTAACAG
rJMSF038O04+ AGGAGAGAATGGAGGCAGTGCAAGCCAGGAAACAGCGTATGATTTCTGGCGCCCTAACAG
rJMSF045F10+ AGGAGAGAATGGAGGCAGTGCAAGCCAGGAAACAGCGTATGATTTCTGGCGCCCTAACAG
                      ____________________________________________________________
consensus AGGAGAGAATGGAGGCAGTGCAAGCCAGGAAACAGCGTATGATTTCTGGCGCCCTAACAG
 
. : . : . : . : . : . :
rJMSF025K05+ ACCAAGAAGTGCGAACAGCACGAATTGAGGAACTTAAGATGTTTTTCACATAGAAAGCTT
rJMSF038O04+ ACCAAGAAGTGCGAACAGCACGAATTGAGGAACTTAAGATGTTTTTCACATAGAAAGCTT
rJMSF045F10+ ACCAAGAAGTGCGAACAGCACGAATTGAGGAACTTAAGATGTTTTTCACATAGAAAGCTT
                      ____________________________________________________________
consensus ACCAAGAAGTGCGAACAGCACGAATTGAGGAACTTAAGATGTTTTTCACATAGAAAGCTT
 
. : . : . : . : . : . :
rJMSF025K05+ CTTCTTCTACTACTTGATCTCTGAAGCTTTTCATTTCAGAGTAAGAACGAAACTCAACAA
rJMSF038O04+ CTTCTTCTACTACTTGATCTCTGAAGCTTTTCATTTCAGAGTAAGAACGAAACTCAACAA
rJMSF045F10+ CTTCTTCTACTACTTGATCTCTGAAGCTTTTCATTTCAGAGTAAGAACGAAACTCAACAA
                      ____________________________________________________________
consensus CTTCTTCTACTACTTGATCTCTGAAGCTTTTCATTTCAGAGTAAGAACGAAACTCAACAA
 
. : . : . : . : . : . :
rJMSF025K05+ CGCAAAACAACTGCTCGTGTAGATGTGTACTAAATGTATTATAACTTTTCCGGTCACAAA
rJMSF038O04+ CGCAAAACAACTGCTCGTGTAGATGTGTACTAAATGTATTATAACTTTTCCGGTCACAAA
rJMSF045F10+ CGCAAAACAACTGCTCGTGTAGATGTGTACTAAATGTATTATAACTTTTCCGGTCACAAA
                      ____________________________________________________________
consensus CGCAAAACAACTGCTCGTGTAGATGTGTACTAAATGTATTATAACTTTTCCGGTCACAAA
 
. : . : . : . : . : . :
rJMSF025K05+ TGCATCCGGGATTGGAGATTTGGCAGTAAGACTGCTTGCAGAGTTAGGAGTACATTATTC
rJMSF038O04+ TGCATCCGGGATTGGAGATTTGGCAGTAAGACTGCTTGCAGAGTTAGGAGTACATTATTC
rJMSF045F10+ TGCATCCGGGATTGGAGATTTGGCAGTAAGACTGCTTGCAGAGTTAGGAGTAC---ATTC
                      ____________________________________________________________
consensus TGCATCCGGGATTGGAGATTTGGCAGTAAGACTGCTTGCAGAGTTAGGAGTACATTATTC
 
. : . : . : . : . : . :
rJMSF025K05+ TAGTGTTCTGTTGTAATGCTCAACAACACATTAGAGATAG-TTTGAAGCCCCT
rJMSF038O04+ TAGTGTTCTGTTGTAATGCTCAACAACACATTAGAGATAG-TTTGAAGCCCCT
rJMSF045F10+ TAGTGTTCTGTTGTAATGCTCAACAACACATTAGAGATAGTTTTGAAGCCCCTCAACTGC
                      ____________________________________________________________
consensus TAGTGTTCTGTTGTAATGCTCAACAACACATTAGAGATAG-TTTGAAGCCCCTCAACTGC