Previous Contig 013595:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF045C19Sequence770008034 (3)gb:AP003840_18340501e-12Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16813013595 (2)gb:HVU507100_16827822e-09Hordeum vulgare partial mRNA for NBS-LRR disease resistance protein homologue (r
JMSF051B16Sequence625008034 (3)gb:AP003840_18340509e-13Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16723013595 (2)gb:AP004463_18413924e-23Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P045

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF051B16+ CCANTACCAAGATAG
                      ____________________________________________________________
consensus CCANTACCAAGATAG
 
. : . : . : . : . : . :
rJMSF051B16+ GTGGATTAATCCTTGGATTAGTACACAAAGCTTTAATGCTCCATTTGAGATTGGAGGATT
                      ____________________________________________________________
consensus GTGGATTAATCCTTGGATTAGTACACAAAGCTTTAATGCTCCATTTGAGATTGGAGGATT
 
. : . : . : . : . : . :
rJMSF051B16+ AGTGTCTTTACAAAAGTTGTGTATTATACAAGCAAATGATACACTTGGCATCAAAACAGT
                      ____________________________________________________________
consensus AGTGTCTTTACAAAAGTTGTGTATTATACAAGCAAATGATACACTTGGCATCAAAACAGT
 
. : . : . : . : . : . :
rJMSF051B16+ GTCTGAGATAGGAAAGCTAACACAACTAAGAAGACTAGCGGTTTCAAAGATGAGACAAGA
                      ____________________________________________________________
consensus GTCTGAGATAGGAAAGCTAACACAACTAAGAAGACTAGCGGTTTCAAAGATGAGACAAGA
 
. : . : . : . : . : . :
rJMSF051B16+ AGATGGCAAAGAATTTTGTTTGTCTTTGGGAAAGTTGACAAA-CCTTTGCTCTTTATCTC
rJMSF045C19+ TGGGAAAGTTGACAAACCCTTTGCTCTTTATCTC
                      ____________________________________________________________
consensus AGATGGCAAAGAATTTTGTTTGTCTTTGGGAAAGTTGACAAACCCTTTGCTCTTTATCTC
 
. : . : . : . : . : . :
rJMSF051B16+ TTACATCAACTTCAGAAGATGAGGTCCTTGATATCCAACATCCTCTACATGTTCCTCTTG
rJMSF045C19+ TTACATCAACTTCAGAAGATGAGGTCCTTGATATCCAACATCCTCTACATGTTCCTCTTG
                      ____________________________________________________________
consensus TTACATCAACTTCAGAAGATGAGGTCCTTGATATCCAACATCCTCTACATGTTCCTCTTG
 
. : . : . : . : . : . :
rJMSF051B16+ GTCTTCAAAGATTATATTTGAAAGGGCCTCTGGAGATGGTACCTCAATGGTTGTCCTTAC
rJMSF045C19+ GTCTTCAAAGATTATATTTGAAAGGGCCTCTGGAGATGGTACCTCAATGGTTGTCCTTAC
                      ____________________________________________________________
consensus GTCTTCAAAGATTATATTTGAAAGGGCCTCTGGAGATGGTACCTCAATGGTTGTCCTTAC
 
. : . : . : . : . : . :
rJMSF051B16+ TTGTAGGCTTAACCTGTTTAGAGTTTGGATGGTGTAGACTTCGTGAAGATTCACTATTGT
rJMSF045C19+ TTGTAGGCTTAACCTGTTTAGAGTTTGGATGGTGTAGACTTCGTGAAGATTCACTATTGT
                      ____________________________________________________________
consensus TTGTAGGCTTAACCTGTTTAGAGTTTGGATGGTGTAGACTTCGTGAAGATTCACTATTGT
 
. : . : . : . : . : . :
rJMSF051B16+ TTATTGAAGATCTGCCCATGTTAGCACATCTAAAACTATTGGCAAAGTCTTATGAAGGGG
rJMSF045C19+ TTATTGAAGATCTGCCCATGTTAGCACATCTAAAACTATTGGCAAAGTCTTATGAAGGGG
                      ____________________________________________________________
consensus TTATTGAAGATCTGCCCATGTTAGCACATCTAAAACTATTGGCAAAGTCTTATGAAGGGG
 
. : . : . : . : . : . :
rJMSF051B16+ AAGGGTTGTGCTTCAAGGCC-AAAAAGTTCTCAAAGCTCAAGTCTTTGATTATCTATAAG
rJMSF045C19+ AAGGGTTGTGCTTCAAGGCCAAAAAAGTTCTCAAAGCTCAAGTCTTTGATTATCTATAAG
                      ____________________________________________________________
consensus AAGGGTTGTGCTTCAAGGCCAAAAAAGTTCTCAAAGCTCAAGTCTTTGATTATCTATAAG
 
. : . : . : . : . : . :
rJMSF051B16+ TTGGAGGCATTGAAATGGATAAGAATGGAGGAAGGTACATTAGATCATCTGGAAGAGTTT
rJMSF045C19+ TTGGAGGCATTGAAATGGATAAGAATGGAGGAAGGTACATTAGATCATCTGGAAGAGTTT
                      ____________________________________________________________
consensus TTGGAGGCATTGAAATGGATAAGAATGGAGGAAGGTACATTAGATCATCTGGAAGAGTTT
 
. : . : . : . : . : . :
rJMSF051B16+ GATTTGGGAGAATGCAGTTTGGTTGAGGAGATGCCGATGGGTATTGAACATTTGTCCGAT
rJMSF045C19+ GATTTGGGAGAATGCAGTTTGGTTGAGGAGATGCCGATGGGTATTGAACATTTGTCCGAT
                      ____________________________________________________________
consensus GATTTGGGAGAATGCAGTTTGGTTGAGGAGATGCCGATGGGTATTGAACATTTGTCCGAT
 
. : . : . : . : . : . :
rJMSF051B16+ CTTAAGGTAATTACTATCTATGACCTTGGCTGACAAATTCAATGCAAATT
rJMSF045C19+ CTTAAGGTAATTACTATCTATGA-CTTGGCTGACAAATTCAATGCAAATTTAGTCTCAAA
                      ____________________________________________________________
consensus CTTAAGGTAATTACTATCTATGACCTTGGCTGACAAATTCAATGCAAATTTAGTCTCAAA
 
. : . : . : . : . : . :
rJMSF045C19+ ATGCAAACGAAGTGAAGTATATGCAAAGATATCTCACATTCCAGAAATTAACATTTCCCA
                      ____________________________________________________________
consensus ATGCAAACGAAGTGAAGTATATGCAAAGATATCTCACATTCCAGAAATTAACATTTCCCA
 
. : . : . : . : . : . :
rJMSF045C19+ TAAAATAGATGGCAAGCGGAAGTTTTTCTTTTAATTTAATGGCGGGTGGTCACGAGATTT
                      ____________________________________________________________
consensus TAAAATAGATGGCAAGCGGAAGTTTTTCTTTTAATTTAATGGCGGGTGGTCACGAGATTT
 
. : . : . : . : . : . :
rJMSF045C19+ AGTATGTGCGTGCTGTATATATCTGAATACTTTGTGATTTTAATTTAGTTGTTTTTCAGA
                      ____________________________________________________________
consensus AGTATGTGCGTGCTGTATATATCTGAATACTTTGTGATTTTAATTTAGTTGTTTTTCAGA
 
. : . : . : . : . : . :
rJMSF045C19+ GTATTAAATTAAAACTTTTGATTGTAATATATATTAATTGATGGTAGCTAGATTATCATA
                      ____________________________________________________________
consensus GTATTAAATTAAAACTTTTGATTGTAATATATATTAATTGATGGTAGCTAGATTATCATA
 
. : . : . : . : . : . :
rJMSF045C19+ TGATTGTATTGTATTGTCTAATATGGCACTTTGATGACCTCTAATACTCTATGAAAGTGT
                      ____________________________________________________________
consensus TGATTGTATTGTATTGTCTAATATGGCACTTTGATGACCTCTAATACTCTATGAAAGTGT