Previous Contig 013594:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF045C09Sequence790013594 (4)pir|C84673|C846734e-19hypothetical protein At2g27470 [imported] - Arabidopsis thaliana>gb:AC006232_153767013594 (4)pir|C84673|C846734e-19hypothetical protein At2g27470 [imported] - Arabidopsis thaliana>gb:AC006232_153
JMSF045J02Sequence792013594 (4)pir|C84673|C846734e-19hypothetical protein At2g27470 [imported] - Arabidopsis thaliana>gb:AC006232_153784013594 (4)pir|C84673|C846734e-19hypothetical protein At2g27470 [imported] - Arabidopsis thaliana>gb:AC006232_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF045C09- GGCGAATTCTCTCAAATTGCCCCAAATTGCCACCGTGAGCCCTAG
JMSF045J02- GCGAATTCTCTCAAATTGCCCCAAATTGCCACCGTGAGCCCTAG
                      ____________________________________________________________
consensus GGCGAATTCTCTCAAATTGCCCCAAATTGCCACCGTGAGCCCTAG
 
. : . : . : . : . : . :
JMSF045C09- TAGACCACGACCACCAATCTGATTCTCTCAAATTGCCTCCGCCGATCTGATTCTACTCCG
JMSF045J02- TAGACCACGACCACCAATCTGATTCTCTCAAATTGCCTCCGCCGATCTGATTCTACTCCG
                      ____________________________________________________________
consensus TAGACCACGACCACCAATCTGATTCTCTCAAATTGCCTCCGCCGATCTGATTCTACTCCG
 
. : . : . : . : . : . :
JMSF045C09- CCGACCAAGACTGTCCACGATCTGAGCCTCCGTCGTGAGCCTCAGCCGACTGCCCGCCAA
JMSF045J02- CCGACCAAGACTGTCCACGATCTGAGCCTCCGTCGTGAGCCTCAGCCGACTGCCCGCCAA
                      ____________________________________________________________
consensus CCGACCAAGACTGTCCACGATCTGAGCCTCCGTCGTGAGCCTCAGCCGACTGCCCGCCAA
 
. : . : . : . : . : . :
JMSF045C09- GACGCCGTGTCTCCTCTGCTGTCGCCAAGACGCCGACCGCCCTCGCCGTCTGCTCACCTG
JMSF045J02- GACGCCGTGTCTCCTCTGCTGTCGCCAAGACGCCGACCGCCCTCGCCGTCTGCTCACCTG
                      ____________________________________________________________
consensus GACGCCGTGTCTCCTCTGCTGTCGCCAAGACGCCGACCGCCCTCGCCGTCTGCTCACCTG
 
. : . : . : . : . : . :
JMSF045C09- ATCGATCGTCGCTGCTCACAGGAAAGGGCAACCATGTTGTCATTGAGCTTAACAATAGTC
JMSF045J02- ATCGATCGTCGCTGCTCACAGGAAAGGGCAACCATGTTGTCATTGAGCTTAACAATAGTC
rJMSF045C09+ CTGCTCACAGGAAAGGGCAACCATGTTGTCATTGAGCTTAACAATAGTC
                      ____________________________________________________________
consensus ATCGATCGTCGCTGCTCACAGGAAAGGGCAACCATGTTGTCATTGAGCTTAACAATAGTC
 
. : . : . : . : . : . :
JMSF045C09- TCCAGATCCGGTTAGTGCTCAGATCTGGTGCTGTGGTGGAGAGAGACGACGAAATGTCAC
JMSF045J02- TCCAGATCCGGTTAGTGCTCAGATCTGGTGCTGTGGTGGAGAGAGACGACGAAATGTCAC
rJMSF045J02+ ATGTCAC
rJMSF045C09+ TCCAGATCCGGTTAGTGCTCAGATCTGGTGCTGTGGTGGAGAGAGACGACGAAATGTCAC
                      ____________________________________________________________
consensus TCCAGATCCGGTTAGTGCTCAGATCTGGTGCTGTGGTGGAGAGAGACGACGAAATGTCAC
 
. : . : . : . : . : . :
JMSF045C09- TTCTCCGCGAGGCTCATCAAGCCTTCTCCGAGAGCGCACGCATCTTCATCCATTACCTCT
JMSF045J02- TTCTCCGCGAGGCTCATCAAGCCTTCTCCGAGAGCGCACGCATCTTCATCCATTACCTCT
rJMSF045J02+ TTCTCCGCGAGGCTCATCAAGCCTTCTCCGAGAGCGCACGCATCTTCATCCATTACCTCT
rJMSF045C09+ TTCTCCGCGAGGCTCATCAAGCCTTCTCCGAGAGCGCACGCATCTTCATCCATTACCTCT
                      ____________________________________________________________
consensus TTCTCCGCGAGGCTCATCAAGCCTTCTCCGAGAGCGCACGCATCTTCATCCATTACCTCT
 
. : . : . : . : . : . :
JMSF045C09- CTACTGTTGCAAATGATGTATGCATGGAGTCTAAGAGGCAAACGATGAATGCAGAAGATG
JMSF045J02- CTACTGTTGCAAATGATGTATGCATGGAGTCTAAGAGGCAAACGATGAATGCAGAAGATG
rJMSF045J02+ CTACTGTTGCAAATGATGTATGCATGGAGTCTAAGAGGCAAACGATGAATGCAGAAGATG
rJMSF045C09+ CTACTGTTGCAAATGATGTATGCATGGAGTCTAAGAGGCAAACGATGAATGCAGAAGATG
                      ____________________________________________________________
consensus CTACTGTTGCAAATGATGTATGCATGGAGTCTAAGAGGCAAACGATGAATGCAGAAGATG
 
. : . : . : . : . : . :
JMSF045C09- TTTTCAATGCTCTTGATGAAATAGAGTTTAGTGAATTTATTGATCCTCTCAGAGCTTCTC
JMSF045J02- TTTTCAATGCTCTTGATGAAATAGAGTTTAGTGAATTTATTGATCCTCTCAGAGCTTCTC
rJMSF045J02+ TTTTCAATGCTCTTGATGAAATAGAGTTTAGTGAATTTATTGATCCTCTCAGAGCTTCTC
rJMSF045C09+ TTTTCAATGCTCTTGATGAAATAGAGTTTAGTGAATTTATTGATCCTCTCAGAGCTTCTC
                      ____________________________________________________________
consensus TTTTCAATGCTCTTGATGAAATAGAGTTTAGTGAATTTATTGATCCTCTCAGAGCTTCTC
 
. : . : . : . : . : . :
JMSF045C09- TTGAAGATTAGGAATGCATGGCTAGCAGAGAATGATAGAATCATTTCTTGGGAGATATGC
JMSF045J02- TTGAAGATTAGGAATGCATGGCTAGCAGAGAATGATAGAATCATTTCTTGGGAGATATGC
rJMSF045J02+ TTGAAGATTAGGAATGCATGGCTAGCAGAGAATGATAGAATCATTTCTTGGGAGATATGC
rJMSF045C09+ TTGAAGATTAGGAATGCATGGCTAGCAGAGAATGATAGAATCATTTCTTGGGAGATATGC
                      ____________________________________________________________
consensus TTGAAGATTAGGAATGCATGGCTAGCAGAGAATGATAGAATCATTTCTTGGGAGATATGC
 
. : . : . : . : . : . :
JMSF045C09- TTTAAGCCGGCTTGTAGGGATGAATTATCAAGCACGGTTGGGCATGATGGTTGCTGGAGC
JMSF045J02- TTTAAGCCGGCTTGTAGGGATGAATTATCAAGCACGGTTGGGCATGATGGTTGCTGGAGC
rJMSF045J02+ TTTAAGCCGGCTTGTAGGGATGAATTATCAAGCACGGTTGGGCATGATGGTTGCTGGAGC
rJMSF045C09+ TTTAAGCCGGCTTGTAGGGATGAATTATCAAGCACGGTTGGGCATGATGGTTGCTGGAGC
                      ____________________________________________________________
consensus TTTAAGCCGGCTTGTAGGGATGAATTATCAAGCACGGTTGGGCATGATGGTTGCTGGAGC
 
. : . : . : . : . : . :
JMSF045C09- ATATGGATTCCCCCAATTTCGCATGCGTGTCTTCATGTGGAGAGGAGAGTTTACCTCCAG
JMSF045J02- ATATGGATTCCCCCAATTTCGCATGCGTGTCTTCATGTGGAGAGGAGAGTTTACCTCCAG
rJMSF045J02+ ATATGGATTCCCCCAATTTCGCATGCGTGTCTTCATGTGGAGAGGAGAGTTTACCTCCAG
rJMSF045C09+ ATATGGATTCCCCCAATTTCGCATGCGTGTCTTCATGTGGAGAGGAGAGTTTACCTCCAG
                      ____________________________________________________________
consensus ATATGGATTCCCCCAATTTCGCATGCGTGTCTTCATGTGGAGAGGAGAGTTTACCTCCAG
 
. : . : . : . : . : . :
JMSF045C09- GTCGAACTATTCTGTCAACCTCCACCATCCAATCCGGTGGAGTTCAATTTGCCTTCTTGA
JMSF045J02- GTCGAACTATTCTGTCAACCTCCACCATCCAATCCGGTGGAGTTCAATTTGCCTTCTTGA
rJMSF045J02+ GTCGAACTATTCTGTCAACCTCCACCATCCAATCCGGTGGAGTTCAATTTGCCTTCTTGA
rJMSF045C09+ GTCGAACTATTCTGTCAACCTCCACCATCCAATCCGGTGGAGTTCAATTTGCCTTCTTGA
                      ____________________________________________________________
consensus GTCGAACTATTCTGTCAACCTCCACCATCCAATCCGGTGGAGTTCAATTTGCCTTCTTGA
 
. : . : . : . : . : . :
JMSF045C09- TGGTTACTAGCTCCCCAACACATGG
JMSF045J02- TGGTTACTANCT-CCCAACACATGG
rJMSF045J02+ TGGTTACTAGCT-CCCAACACATGGACACTGTTAGAGCAGACATTTCTGGGAAGAAAGAT
rJMSF045C09+ TGGTTACTAGCT-CCCAACACATGGACACTGTTAGAGCAGACATTTCTGGGAAGAAAGAT
                      ____________________________________________________________
consensus TGGTTACTAGCT-CCCAACACATGGACACTGTTAGAGCAGACATTTCTGGGAAGAAAGAT
 
. : . : . : . : . : . :
rJMSF045J02+ GTGACAGACCTGAATATATCATTCAATTTTGTGGGACAGAGAGTCAAGGAAAGGAAAGGA
rJMSF045C09+ GTGACAGACCTGAATATATCATTCAATTTTGTGGGACAGAGAGTCAAGGAAAGGAAAGGA
                      ____________________________________________________________
consensus GTGACAGACCTGAATATATCATTCAATTTTGTGGGACAGAGAGTCAAGGAAAGGAAAGGA
 
. : . : . : . : . : . :
rJMSF045J02+ AAGATTGAAGTCCTCCTCCTCCCTTTCCATATCTGCACATCCTCTTCAAGCTTAAGCTTA
rJMSF045C09+ AAGATTGAAGTCCTCCTCCTCCCTTTCCATATCTGCACATCCTCTTCAAGCTTAAGCTTA
                      ____________________________________________________________
consensus AAGATTGAAGTCCTCCTCCTCCCTTTCCATATCTGCACATCCTCTTCAAGCTTAAGCTTA
 
. : . : . : . : . : . :
rJMSF045J02+ TTTTTANCTGTGTAATTTTGTGAAAATTTCTTTGTTAAACTTTTCCTTTGGCTGTAATTT
rJMSF045C09+ TTTTTA-CTGTGTAATTTTGTGAAAATTTCTTTGTTAAACTTTTCCTTTGGCTGTAATTT
                      ____________________________________________________________
consensus TTTTTANCTGTGTAATTTTGTGAAAATTTCTTTGTTAAACTTTTCCTTTGGCTGTAATTT